PCR Procedure was as follows. The RNA solution was extracted using a simple filter paper-based method [13 (link)]. The RNA solution was stored at − 80 °C until use, and 1 µl of the supernatant was used as the template. Using PrimeScript One-Step RT-PCR Kit Ver.2 (Takata Bio, Shiga, Japan), one-step real-time mRT-PCR was performed in 10 μl of the reaction mixture, which contained 1 µl of the RNA solution, 1 × EvaGreen (Biotium Inc., CA, USA), 0.1 × ROX Reference Dye (Thermo Fisher Scientific, Waltham, MA, USA), 1 × 1 Step buffer and 1 × PrimeScript 1 Step Enzyme Mix. A real-time PCR system, QuantStudio 3 (Thermo Fisher Scientific), was programmed for each step shown in Table
Optimized RT-PCR program using Quant Studio 3
Process | RTc | PCR (40cycle) | Melting curve analysis | |||||
---|---|---|---|---|---|---|---|---|
Subprocess | cDNA synthesis | Denature | Denature | Annealing-Elongation | Denature | Annealing | Meltingd | Hold |
Tmpa | 50 °C | 95 °C | 95 °C | 58 °C | 95 °C | 60 °C | 0.03 °C/s | 95 °C |
Time | 5 min | 10 s | 5 s | 31 s | 15 s | 15 s | 1 s | |
Measureb | ● | ● |
aTemperature
bMeasure fluorescent intensity in the steps marked with black dot (●)
cReverse transcription
dTemperature was increased 0.03 °C per second in this step to dissociate dsDNA gradually
Primers information and amplicons Tm values
Target | Polarity | Primer Sequence (5'–3')a | Final conc. (µM) | Amplicon size (bp) | Genome sequenceb | Calculated amplicon Tm (°C) | Measured ampicon Tmc (°C) |
---|---|---|---|---|---|---|---|
PLRV | F | AAGAAGGCAATCCCTTCG | 0.25 | 155 | LC501445 | 87.5 | 87.6 ± 0.3 |
R | ATGTCTCGCTTGAGCCTC | ||||||
PVS | F | TCGTBTGGAATTACATGCTMG | 0.50 | 102 | AB451180 (PVSO) | 81.0 | 82.2 ± 0.1 |
R | ATCAAATGTGTCAAAWGCGG | LC492754 (PVSA) | 82.5 | 83.1 ± 0.3 | |||
PVX | F | TTCGACTTCTTCAATGGAGTC | 0.11 | 189 | AB451181 | 84.5 | 85.9 ± 0.2 |
R | TCCAGTGATACGACCTCG | ||||||
PVY | F | TGAAAATGGAACCTCGCC | 0.14 | 129 | AB451181 (PVYO) | 79.0 | 80.5 ± 0.4 |
R | AATGTGCCATGATTTGCC | AB331515 (PVYNA-N) | 78.0 | 79.4 ± 0.2 | |||
AB702945 (PVYNTN) | 79.0 | 80.5 ± 0.3 | |||||
EF1α | F | TACTCCAAGGCTAGGTATGATG | 0.22 | 74 | 74.0–75.0 | ||
R | TCAGGGTTGTAACCGACC |
aWritten according to the International Union of Pure and Applied Chemistry (IUPAC)
bGenBank accessions (lineage for PVS or strain for PVY) of isolates used for the calculation and the measurement of Amplicon Tm values were shown, corresponding to the values in the same line. For potato EF1α, five sequences of mRNA (GenBank accessions DQ2288628, DQ222490, AJ536671, AB061263, and KF537426) were used
cMeasured Tm values were shown, and the values meant “(Average Tm value) ± 2 × (Standard error).”