Venor gem classic mycoplasma detection kit

B-CPAP (PDTC), SW1736 (anaplastic thyroid cancer, ATC), HTCC3 (ATC) and human embryonic kidney (HEK) 293T cells were grown in DMEM (Gibco); SW579 (PDTC of squamous TC origin) and FTC133 (metastatic aggressive FTC) cells were grown in DMEM/F12 (Gibco); FRO (ATC) cells were grown in RPMI supplemented with L-Glutamine (Euroclone) in a humidified incubator at 37 °C under 5% CO2. All media were supplemented with 10% fetal bovine serum (Sigma Aldrich) and penicillin-streptomycin mixture (Sigma Aldrich). All experiments were performed with cell lines in between the 8th and 18th passage.

PDTC and ATC cell lines were kindly provided by Dr. I. Bongarzone (Istituto Nazionale dei Tumori, Milan, Italy). HEK293T cell line was kindly gifted by Professor V. Silani (Istituto Auxologico Italiano, Milan, Italy).

All cell lines were authenticated by short tandem repeat (STR) profiling.

All cell lines were routinely screened for mycoplasma contamination with Venor®GeM Classic Mycoplasma Detection Kit (Minerva Biolabs®).

HEK293T cells (American Type Culture Collection, CRL-3216), NIH3T3 cells (American Type Culture Collection, CRL-1658) and its derivatives (NIH3T3-nAC-tagGFP) were maintained in high-glucose Dulbecco´s modified Eagle´s medium (DMEM, anprotec) supplemented with 10% fetal calf serum (FCS, anprotec), 100 U ml⁻¹ penicillin and 100 µg ml⁻¹ streptomycin (anprotec) at 37 °C in a 5% CO₂ atmosphere. All cells were regularly tested for mycoplasma contamination using the VenorGem Classic Mycoplasma detection kit (Minerva Biolabs). Calcium elevations in cells were induced via the addition of the calcium ionophore A23187 (Sigma) as indicated in the respective experiments. Plasmid DNA transfections were conducted using FuGene HD transfection reagent (Promega) according to the supplier’s protocol. For siRNA-mediated protein depletion, cells were transfected with targeting or non-targeting siRNA using Lipofectamine RNAiMAX (Invitrogen). Experiments involving SUN2, INF2, nesprin1 (Syne1), nesprin2 (Syne2) and nesprin3 (Syne3) depletion were conducted 72 h post transfection. The utilized targeting sequences and siRNAs were as follows:
Ctrl, AllStars Negative Control siRNA, AATTCTCCGAACGTGTCACGT (Qiagen, no. 1027281);
Inf2, TAGGCTCTAGGGAACAAATAA (Qiagen, no. SI00822031);
Sun2 #1, CACGTAGAACTCCCTGCATAA (Qiagen, no. SI00912765);
Sun2 #2, CCGGTTAGTGTTCGGGTGAAA (Qiagen, no. SI00912772);
Syne1, GGAUGGAACUAGAACAUAU (Thermo Fisher Scientific, no. s234287);
Syne2, GAGCUUUUGACUCAUGUACAGUAAA (OriGene Techn., no. SR23729C);
Syne3, AAGCUACGUAGAAUCAUCACAAUGA (OriGene Techn., no. SR421519B);
Negative control siRNA, CGUUAAUCGCGUAUAAUACGCGUAT (OriGene Techn., no. SR3004).
For Emd depletion, cells were transfected with a 1:1 mixture of two siRNAs at day 0 and day 2, and subsequent experiments were performed on day 4. The following siRNAs were used:
Emd, GGCUUAUCAUAUUAUCCUA and CUAUAAUGAUGACUACUAU (Invitrogen, no. s65469 and no. s65468).