The Y2H assays were performed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech, Mountain View, CA, USA). The full-length and truncated coding regions of WL1 were amplified and cloned into the yeast expression vector pGADT7 (Clontech) and pGBKT7 (Clontech) to produce pGADT7-WL1, pGADT7-N-WL1, pGADT7-C-WL1, pGADT7-mWL1 and pGBKT7-WL1, pGBKT7-N-WL1, pGBKT7-C-WL1, pGBKT7-mWL1, respectively. The full-length coding regions of TAD1, OsTPR1, OsTPR2, and OsTPR3 were cloned into the vector pGBKT7 (Clontech) to produce pGBKT7-TAD1, pGBKT7-OsTPR1, pGBKT7-OsTPR2, and pGBKT7-OsTPR3. The Y2H Gold yeast strain was used in the Y2H assays. pGADT7-T1pGBKT7-lam and pGADT7-T1pGBKT7-53 served as the negative and positive controls, respectively. According to the manufacturer's instructions, these plasmids were co-transformed into the Y2H Gold yeast strain in an activation domain-BD coupled manner (Yeast Protocols Handbook, PT3024-1; Clontech). The primers used are listed in Supplemental Data Set 1.
Pgbkt7
Manufactured by Takara Bio
Sourced in United States, Japan, China, Germany, United Kingdom, France
The PGBKT7 is a plasmid vector used for gene expression in yeast cells. It contains a yeast selectable marker and a multiple cloning site for the insertion of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Pgadt7, by Takara Bio (229 mentions)
Pgadt7 vector, by Takara Bio (27 mentions)
Y2hgold, by Takara Bio (21 mentions)
Matchmaker gold yeast two hybrid system, by Takara Bio (19 mentions)
Ah109, by Takara Bio (16 mentions)
Yeastmaker yeast transformation system 2, by Takara Bio (11 mentions)
Pgadt7 rec, by Takara Bio (10 mentions)
Yeast protocols handbook, by Takara Bio (9 mentions)
Pact2, by Takara Bio (9 mentions)
Pgadt7 t, by Takara Bio (6 mentions)
Pgbkt7 lam, by Takara Bio (6 mentions)
In fusion hd cloning kit, by Takara Bio (5 mentions)
Pgbkt7 p53, by Takara Bio (5 mentions)
Pgadt7 ad, by Takara Bio (5 mentions)
Matchmaker gal4 two hybrid system 3, by Takara Bio (5 mentions)
Saccharomyces cerevisiae strain ah109, by Takara Bio (4 mentions)
Rneasy plant mini kit, by Qiagen (4 mentions)
Yeast two hybrid system user manual, by Takara Bio (4 mentions)
Matchmaker two hybrid system 3, by Takara Bio (4 mentions)
Pgbkt7 53, by Takara Bio (4 mentions)
413 protocols using pgbkt7
1
Yeast Two-Hybrid Assay for Protein-Protein Interactions
2
Yeast Two-Hybrid Assay for Transcription Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length CDS of IpASR and three truncated IpASRs were cloned into vector pGBKT7 (Clontech, Mountain View, CA, USA) for transcription activation analysis. These constructs along with the negative control pGBKT7 and pGBKT7-Lam plasmids, or positive control pGBKT7-53 plasmid, were transformed into Saccharomyces cerevisiae strain AH109 using the lithium acetate mediated method according to the Yeast Protocols Handbook (Clontech, Mountain View, CA, USA), and the vector pGADT7-T was co-transformed with all of the above constructs and positive/negative contorls (pGBKT7-53, pGBKT7, and pGBKT7-Lam). The yeast clones was cultured in liquid SD-2 medium to OD600 until 1.0, after which they were diluted using a gradient dilution (1:10, 1:100, and 1:1000). Two-microliter yeast cultures were spotted onto the corresponding synthetically defined (SD/-Trp/-Leu and SD/-Trp/-Leu/-His) medium plates for 2 days at 30 °C. Yeast transformation and determination of blue/white colonies were conducted according to the instructions of the manufacturer (Clontech), and X-α-Gal was used as a substrate for the reporter gene MEL1. Primers used for plasmid construction are shown in Supplementary Materials Table S2 .
3
Transactivation Assay of VviMYB86 in Yeast
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A transactivation assay of VviMYB86 in yeast (Saccharomyces cerevisiae) was performed following the method described by Wang et al. (2016) (link). The ORFs of VviMYB86, VviMYBPAR (GenBank No. AB911341), and VviMYBC2-L1 (GenBank No. EU181425) were cloned with specific primer pairs (Supplementary Table 1 ) and integrated into the yeast expression vector pGBKT7 (Takara, Japan). The expression vectors pGBKT7-VviMYB86, pGBKT7-VviMYBPAR (positive control), pGBKT7-VviMYBC2-L1 (negative control), and pGBKT7 (negative control) were transferred into a yeast host strain AH109 according to the manufacturer’s protocol (PT4087-1, Clontech, Japan). Successfully transformed yeast strains were applied onto the corresponding medium (SD/Trp-, SD/Trp-/His-, and SD/Trp-/His-/Ade-) and subsequently observed after being incubated at 30°C for 3–5 days.
4
Yeast Two-Hybrid for ZmPIF4/5 and RGA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids pGBKT7-ZmPIF4 and pGBKT7-ZmPIF5 were generated by PCR-amplifying the coding region of ZmPIF4 and ZmPIF5 from 35Spro::ZmPIF4-3FLAG and 35Spro::ZmPIF5-3FLAG using the primer pairs ADBD-ZmPIF4-F and ADBD- ZmPIF4-R, and ADBD-ZmPIF5-F and ADBD-ZmPIF5-R. The fragments containing the coding region of ZmPIF4 and ZmPIF5 were inserted into pGBKT7 (Clontech) digested with BamHI and NdeI to produce pGBKT7-ZmPIF4 and pGBKT7-ZmPIF5.
The plasmid pGADT7-RGA was generated by PCR-amplifying the coding region of RGA from Arabidopsis Col-0 with the primer pair ADBD-RGA-F and ADBD-RGA-R. Then, the fragment containing the RGA coding region was inserted into pGADT7 (Clontech) digested with BamHI and SacI to produce pGADT7-RGA. The yeast two-hybrid procedure was performed following the manufacturer’s instructions (Clontech).
The plasmid pGADT7-RGA was generated by PCR-amplifying the coding region of RGA from Arabidopsis Col-0 with the primer pair ADBD-RGA-F and ADBD-RGA-R. Then, the fragment containing the RGA coding region was inserted into pGADT7 (Clontech) digested with BamHI and SacI to produce pGADT7-RGA. The yeast two-hybrid procedure was performed following the manufacturer’s instructions (Clontech).
5
Yeast Two-Hybrid Screening of Xyr1 Domains in T. reesei
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Preparation of the cDNA library from mycelia of the strain QM9414 induced on Avicel was carried out as described previously by Cao Y etal.24 .
For constructing the bait vector for yeast two-hybrid screening, the Xyr1 coding sequences either for its putative activation domain (AD, aa 767~940) or the middle homology domains (MHR1, aa 314~772 and MHR2, aa 314~632) were amplified from T. reesei cDNA with primers containing NdeI and BamHI sites. The digested DNA fragments were ligated into pGBKT7 (Clontech) to obtain pGBKT7-Xyr1AD, pGBKT7-MHR1 and pGBKT7-MHR2, respectively.
The bait plasmid pGBKT7-Xyr1AD was transformed into the yeast Y2H Gold strain by a PEG-LiAC method to obtain the bait strain36 (link). Ten micrograms of T. reesei cDNA library plasmid was then transformed into the bait strain and transformants were selected on SC plates lacking tryptophan and leucine but containing 100 ng ml-1 AbA. Growing colonies were picked and the harbored plasmids with cDNA insert were verified by DNA sequencing after retransformation.
For constructing the bait vector for yeast two-hybrid screening, the Xyr1 coding sequences either for its putative activation domain (AD, aa 767~940) or the middle homology domains (MHR1, aa 314~772 and MHR2, aa 314~632) were amplified from T. reesei cDNA with primers containing NdeI and BamHI sites. The digested DNA fragments were ligated into pGBKT7 (Clontech) to obtain pGBKT7-Xyr1AD, pGBKT7-MHR1 and pGBKT7-MHR2, respectively.
The bait plasmid pGBKT7-Xyr1AD was transformed into the yeast Y2H Gold strain by a PEG-LiAC method to obtain the bait strain36 (link). Ten micrograms of T. reesei cDNA library plasmid was then transformed into the bait strain and transformants were selected on SC plates lacking tryptophan and leucine but containing 100 ng ml-1 AbA. Growing colonies were picked and the harbored plasmids with cDNA insert were verified by DNA sequencing after retransformation.
6
Yeast Two-Hybrid Assay for Protein-Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The inserts containing DNA sequences encoding human sKL (1–1,647 nt in CDS; GenBank: AB009667.2 ) and IGF1R (4,110 nt; GenBank: NM_010513.2 ) were cloned and then cloned into the vectors pGADT7 (Clontech; 630442) and pGBKT7 (Clontech; 631604) using homologous recombination, respectively (ClonExpress II One Step Cloning Kit; Vazyme, Nanjing, China) The yeast strain Y187 (Clontech; 630457) was transformed with pGADT7, and Y2HGold (Clontech; 630498) was transformed with pGBKT7; the fusion plasmids were transformed into yeast strains Y187 and Y2HGold, respectively, following a lithium acetate protocol.38 (link) Yeast cotransformed with pGBKT7-Lam and pGADT7-T was used as a negative control, and yeast cotransformed with pGBKT7-53 and pGADT7-T was used as a positive control. The transformants were grown on synthetically defined double dropout (DDO; SD/-Leu/-Trp) medium plates for 2–3 days. The yeast cells with cotransformation of the fusion plasmids were further dropped on QDO/X/A (SD/-Ade/-His/-Trp/-Leu/-Trp/X-α-gal/AbA) dropout medium plates with a series of 10-fold dilutions (from 106 to 104) for checking the interactions. Exclusion of recombinant plasmids was nontoxic to yeast strains and had no self-transcriptional activation activity. The primer pairs used for yeast two-hybrid experiments in this study are described in Table S2 .
7
Cloning and Characterization of SjAUREO Bait Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
With the identified information of full-length SjAUREO protein in our previous research [13 (link)], the SjAUREO was amplified from the S. japonica cDNA by using forward (CAAGAGGCCATTACGGCCATGTCGGAGCAGCAGAAGCTGG) and reverse (AACGGATCCCCGCAGCCCCTGTACGGCAACGAAAAAC) primers containing the Sfi I and BamH I restriction sites. The SjAUREO bait vector (pGBKT7-AUREO) was constructed using the appropriate restriction enzymes (TaKaRa Bio Inc., Otsu, Japan), in order to clone the SjAUREO gene into pGBKT7 (Clontech Laboratories, Dalian, China). The pGBKT7-AUREO was sequenced prior to transformation to ensure that the bait protein (SjAUREO) encodes the correct reading frame of the GAL4 DNA binding domain. The fused construct pGBKT7-AUREO was subsequently transformed into the Y2HGold yeast strain according to the user manual of the Yeast-maker™ Yeast Transformation System 2 (Clontech Laboratories, Dalian, China). The toxicity and auto-activation of bait protein were examined according to the user manual of the Matchmaker™ Gold Yeast Two-Hybrid System (Clontech Laboratories, Dalian, China).
8
Cloning and Expression Vectors for ATG8E and ABCD1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the pGADT7-ATG8E, pGBKT7-ATG8E, pGADT7-ABCD1 B walker motif and pGBKT7-ABCD1 B Walker motif constructs, the complete ATG8E coding sequence and ABCD1 B Walker motif coding sequence were recombined into the vectors pGADT7 and pGBKT7 (Clontech, 630442 and 630443). To construct the HA-GFP-ATG8E and FLAG-GFP-ABCD1-B Walker motif expression vectors, the full-length cDNA fragments of ATG8E and the coding sequence of ABCD1-B (B Walker motif) were inserted into pUC120-HA-GFP and pUC119-FLAG-GFP to fuse with 2X HA and 2X FLAG, respectively.
9
Constructing VP37 Bait Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Previous studies have indicated that the full-length VP37 protein could autonomously activate reporter genes in the absence of the prey protein; therefore, a truncated C-terminal VP37 (aa 1–247) was constructed in the present work. The truncated C-terminal VP37 was amplified from the WSSV genome by using forward and reverse primers containing the NdeI and PstI restriction sites: VP37Y-F (5′- TTCGGCATATGGCGGTAAACTTGGAT-3′ ) and VP37Y-R (5′-TCACTGCAGTCTGTTGTTTTCAGCGACAC-3′ ). The VP37 bait vector (pGBKT7-37) was constructed using the appropriate restriction enzyme (TaKaRa Bio Inc., Otsu, Japan), in order to clone the VP37 genes into pGBKT7 (Clontech Laboratories). The pGBKT7-37 was sequenced prior to transformation to ensure that the bait protein (VP37) encodes in the correct reading frame of the GAL4 DNA binding domain; pGBKT7-37 was subsequently transformed into the Y2HGold yeast strain (Clontech Laboratories) according to the user manual of the Yeastmaker™ Yeast Transformation System 2 (Clontech Laboratories). The toxicity and auto-activation of bait protein were examined according to user manual of the Matchmaker™ Gold Yeast Two-Hybrid System (Clontech Laboratories).
10
Cloning and Yeast Screening for Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA for cloning the cDNA library into pGAD vectors was extracted from wild-type plants using Matchmaker Library Construction and Screening Kits (Clontech, Shiga, Japan). Yeast screening was performed using truncated SDG725 protein (SDG725C, amino acids 1240–2150) as the bait by yeast mating. Full-length or truncated CDS of OsSUF4, SDG725, and ZNF207 were amplified and cloned into pGADT7 or pGBKT7 (Clontech) using the primers listed in Supplementary Data 1 , resulting in constructs pGADT7-OsSUF4, pGADT7-OsSUF4N, pGADT7-OsSUF4C, pGADT7-ZNF207, pGBKT7–725C, and pGBKT7-SETD2. The yeast two-hybrid assay was performed according to the manufacturer’s protocol (Clontech) and the interaction was screened on media lacking tryptophan, leucine, and adenine (SD −W/−L/−A).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!