SBV and DWV were purified as described previously.[12b , 29 ] Briefly: one hundred experimentally infected honeybee pupae were homogenized using a Dounce homogenizer (piston‐wall distance 0.075 mm) in 50 mL of phosphate buffered saline (PBS) on ice. The extract was centrifuged at 15,000×g for 30 min at 10 °C. The pellet was discarded, and the supernatant was ultracentrifuged at 150,000×g for 3 h in a Ti50.2 fixed‐angle rotor (Beckman‐Coulter) at 10 °C. The resulting pellet was resuspended in PBS in a final volume of 10 mL. MgCl2 was added to a final concentration of 5 mM as well as 20 μg/mL of DNase I and 20 μg/mL of RNase. The solution was incubated at room temperature for 30 min and centrifuged for 15 min at 5,500 g at room temperature. The resulting supernatant was loaded onto 0.6 g/mL CsCl in PBS and centrifuged for 16 h at 30,000 rpm in an SW41 swinging‐bucket rotor at 10 °C (Beckman‐Coulter). Virus bands were collected by the gentle piercing of ultracentrifuge tubes with an 18‐gauge needle. The viruses were buffer‐exchanged to PBS and concentrated using centrifuge filter units with a 100‐kDa molecular mass cutoff.
Ti50.2 fixed angle rotor
Manufactured by Beckman Coulter
6 citations
About the product
The Ti50.2 fixed-angle rotor is a centrifugation equipment designed for high-speed separations. It is capable of reaching a maximum speed of 50,000 rpm and can generate a maximum relative centrifugal force (RCF) of 289,000 x g. The rotor is constructed with titanium alloy, ensuring durability and corrosion resistance.
Automatically generated - may contain errors
Market Availability & Pricing
Is this product still available?
Get pricing insights and sourcing optionsLab products found in correlation
Dounce homogenizer, by Merck Group (3 mentions)
Sw41 swinging bucket rotor, by Beckman Coulter (2 mentions)
Rna purification kit, by Qiagen (1 mentions)
8 kda mwco dialysis tubing, by Biodesign (1 mentions)
Rna purification kit, by Thermo Fisher Scientific (1 mentions)
Ion torrent, by Thermo Fisher Scientific (1 mentions)
Phosphate buffered saline (pbs), by Merck Group (1 mentions)
Check compatibility
6 protocols using «ti50.2 fixed angle rotor»
1
Purification of Honeybee Virus Particles
Corresponding organizations : Charles University, Czech Academy of Sciences, Institute of Organic Chemistry and Biochemistry, Central European Institute of Technology, Central European Institute of Technology – Masaryk University, Czech Academy of Sciences, Institute of Molecular Genetics, University of South Bohemia in České Budějovice, University of Chemistry and Technology
2
Honeybee Virus Purification Protocol
Honeybee viruses were purified as described previously (13 (link), 16 (link), 52 (link)). Briefly, 50 experimentally infected honeybee pupae were homogenized with a Dounce homogenizer (piston-wall distance of 0.075 mm) in 30 ml of PBS [Dulbecco’s Phosphate-Buffered Saline Modified, D8537, Sigma-Aldrich; 2.7 mM KCl, 136.9 mM NaCl, 1.5 mM KH2PO4, and 8.1 mM Na2HPO4 (pH 7.4)] on ice. The extract was centrifuged at 15,000g for 30 min at 10°C. The pellet was discarded, and the supernatant was ultracentrifuged at 150,000g for 3 hours in a Ti50.2 fixed-angle rotor (Beckman-Coulter) at 10°C. The resulting pellet was resuspended in PBS in a final volume of 5 ml. MgCl2 was added to a final concentration of 5 mM, as well as 20 μg/ml of deoxyribonuclease I and 20 μg/ml of RNase. The solution was incubated at room temperature for 30 min and centrifuged for 15 min at 5500g at room temperature. The resulting supernatant was separated using a CsCl (0.6 g/ml) gradient in PBS by ultracentrifugation for 16 hours at 30,000 rpm in an SW41 swinging-bucket rotor at 10°C (Beckman-Coulter). Virus bands were collected by the gentle piercing of ultracentrifuge tubes with an 18-gauge needle. The viruses were buffer exchanged to PBS and concentrated using centrifuge filter units with a 100-kDa molecular mass cutoff.
Corresponding organizations : Central European Institute of Technology, Central European Institute of Technology – Masaryk University, Masaryk University, Mendel University in Brno
3
Purification and Sequencing of BQCV
Fifty experimentally infected honeybee pupae were homogenized with a Dounce homogenizer in 30 ml of phosphate-buffered saline (PBS), pH 7.5 (Sigma-Aldrich). The nonionic detergent NP-40 was added to a final concentration of 0.5%, and the homogenate was incubated for 1 h at room temperature. The extract was centrifuged at 8,000 × g for 30 min. The pellet was discarded and the supernatant was centrifuged at 150,000 × g for 3 h in a Ti50.2 fixed-angle rotor (Beckman Coulter). The resulting pellet was resuspended in PBS to a final volume of 5 ml. MgCl2 was added to a final concentration of 5 mM; 20 μg/ml of DNase I and 20 μg/ml of RNase were added as well. The solution was incubated at room temperature for 30 min and centrifuged at 4,000 × g for 15 min. The resulting supernatant was loaded into a CsCl (0.6 g/ml) solution prepared in PBS. The ultracentrifugation at 220,000 × g proceeded for 16 h to establish the CsCl gradient. BQCV formed a single band in the CsCl gradient. The virus band was collected by gentle piercing of the ultracentrifuge tubes with an 18-gauge needle. The viruses were transferred to PBS by several rounds of concentration and dilution using centrifuge filter units with a 100-kDa molecular mass cutoff. This procedure yielded about 300 μg of virus with purity sufficient for screening. The nucleotide sequences of the virus preparations were determined by sequencing the RNA region encoding the capsid proteins. RNA was extracted from 10 infected honeybee pupae using TRIzol reagent. Viral RNA was reverse transcribed into cDNA using oligo(T) primers, which was used for commercial sequencing. The identical approach was used to prepare cDNA for detection of virus replication in pupae injected with BQCV from dissolved crystals. The primers used for subsequent PCR were 2F, with the sequence ACTCAAAGGATTTTCTTCTT, and 4R, with the sequence AAATAGGTCCTATGATTTCA. The resulting product was 599 bp in length.
Corresponding organizations : Central European Institute of Technology, Central European Institute of Technology – Masaryk University, Mendel University in Brno, Swedish University of Agricultural Sciences
4
Purification of Deformed Wing Virus from Honeybee Pupae
Fifty experimentally infected honeybee pupae were homogenized with a Dounce homogenizer in 30 ml of phosphate-buffered saline (PBS), pH 7.5 (Sigma-Aldrich). The nonionic detergent NP-40 was added to a final concentration of 0.5%, and the homogenate was incubated for 1 h at room temperature. The extract was centrifuged at 8,000 × g for 30 min. The pellet was discarded, and the supernatant was centrifuged at 150,000 × g for 3 h in a Ti50.2 fixed-angle rotor (Beckman-Coulter). The resulting pellet was resuspended in PBS to a final volume of 5 ml. MgCl2 was added to a final concentration of 5 mM, as well as 20 μg/ml DNase I and 20 μg/ml RNase. The solution was incubated at room temperature for 30 min and centrifuged at 4,000 × g for 15 min. The resulting supernatant was loaded onto a CsCl (0.6-g/ml) solution prepared in PBS. The ultracentrifugation proceeded for 16 h to establish the CsCl gradient. Virus bands were collected by gentle piercing of the ultracentrifuge tubes with an 18-gauge needle. The viruses were transferred to PBS by several rounds of concentration and dilution using centrifuge filter units with a 100-kDa molecular mass cutoff. This procedure yielded about 300 μg of virus with a purity sufficient for crystallization screening. Sample purity with respect to contaminating honeybee viruses was checked by reverse transcription-quantitative PCR (RT-qPCR), using previously reported virus-specific assays (34 ). In both preparations, the total sum of contaminating viruses was less than 1% of the virus of interest. The nucleotide sequences of the virus preparations were determined by sequencing 300 ng of RNA, purified using a Qiagen RNA purification kit, by IonTorrent (Thermo Fisher Scientific) technology and standard protocols for library preparation and sequencing. The IonTorrent reads were mapped to the IAPV GenBank reference sequence NC_009025 using Tmap v4.4.8, included in TorrentSuite 4.4.2, with Life Technologies-recommended parameters. Variability and consensus sequences were created using mpileup from samtools v.0.1.8 and an in-house script.
Corresponding organizations : Central European Institute of Technology, Central European Institute of Technology – Masaryk University, Mendel University in Brno, Swedish University of Agricultural Sciences
5
Purification of Small Black Queen Cell Virus
Fifty to 70 experimentally infected honeybee pupae were homogenized with a Dounce homogenizer in 30 ml of phosphate-buffered saline (PBS), pH 7.5 (Sigma-Aldrich). The nonionic detergent NP-40 was added to a final concentration of 0.5%, and the homogenate was incubated for 1 h at room temperature. The extract was centrifuged at 8,000 × g for 30 min. The pellet was discarded and the supernatant was centrifuged at 150,000 × g for 3 h in a Ti50.2 fixed-angle rotor (Beckman-Coulter). The resulting pellet was resuspended in PBS to a final volume of 5 ml. MgCl2 was added to a final concentration of 5 mM, along with 20 μg/ml of DNase I and 20 μg/ml of RNase. The solution was incubated at room temperature for 30 min and centrifuged at 4,000 × g for 15 min. The resulting supernatant was loaded onto a CsCl (0.6-g/ml) solution prepared in PBS. The ultracentrifugation proceeded for 16 h to establish the CsCl gradient. Virus bands were collected by gentle piercing of the ultracentrifuge tubes with an 18-gauge needle. The viruses were transferred to PBS by several rounds of concentration and dilution using centrifuge filter units with a 100-kDa-molecular-mass cutoff. This procedure yielded about 300 μg of virus with a purity sufficient for sparse-matrix crystallization screening experiments. Sample purity with respect to contaminating honeybee viruses was checked by reverse transcription-quantitative PCR (RT-qPCR) using previously reported virus-specific assays (22 ). In both preparations, the total sum of contaminating viruses was less than 1% of the virus of interest. The nucleotide sequences of the virus preparations were determined by sequencing 300 ng of RNA, purified using a Qiagen RNA purification kit, by IonTorrent technology and standard protocols for library preparation and sequencing. The IonTorrent reads were mapped to the SBPV GenBank reference sequence EU035616 (SBPV) using Tmap v4.4.8, included in TorrentSuite 4.4.2, with Life Technologies-recommended parameters. Variability and consensus sequences were created using mpileup from samtools v.0.1.8 and an in-house script.
Corresponding organizations : Central European Institute of Technology – Masaryk University, Central European Institute of Technology, Mendel University in Brno, Swedish University of Agricultural Sciences
Top 1 most cited protocols using «ti50.2 fixed angle rotor»
1
Enriching Aplysia Hemocyanin by Ultracentrifugation
Ultracentrifugation was used to enrich the active fraction from hemolymph and selectively remove hemocyanin, a respiratory protein that is the major constituent of Aplysia hemolymph25 (link). Cell-free hemolymph was first centrifuged with a 2 M sucrose cushion at 193,000 RCF for 4 hours in a Beckman Optima L-90K Ultracentrifuge at 4°C with a Ti 50.2 fixed angle rotor (Beckman-Coulter). The pellet fraction, which contained the high molecular weight proteins including hemocyanin, was dialyzed against ASW using 8 kDa MWCO dialysis tubing (BioDesign, Carmel, NY). This was justified on account of the similarity between the ionic composition of hemolymph and sea water62 (link). Hemocyanin was induced to oligomerize by the addition of 100 mM CaCl2 and 100 mM MgCl2 to the pellet fraction40 (link). Hemolymph with added CaCl2 and MgCl2 was kept at 4°C for six days then centrifuged for 2 hours at 88,000 RCF as above. SDS-PAGE analysis showed that a protein profile resembling hemocyanin was present in the pellet after this step.
Corresponding organizations : Yale University
Spelling variants (same manufacturer)
Similar products (other manufacturers)
The spelling variants listed above correspond to different ways the product may be referred to in scientific literature.
These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!
🧪 Need help with an experiment or choosing lab equipment?
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
1. Protocol search & design
(papers, patents, application notes)
(papers, patents, application notes)
2. Protocol validation
(from literature and MDAR)
(from literature and MDAR)
3. Lab Product search
4. Product validation from literature
5. Troubleshoot product/ protocol
6. Instant figure generation New
Want to copy this response? Create your account to unlock copy/paste and export options.