Lightcycler 480

Cells grown in three wells of a 24-well plate were pooled for RNA isolation with Trizol according to manufacturer’s protocol. One-step quantitative RT-PCR for ZIKV and the ribosomal housekeeping gene S7 RNA was performed using specific primers (Supplementary Table S2), SYBR Green master mix (QuantiTect SYBR Green RT-PCR Kit, Qiagen, Germany) and a LightCycler 480 (Roche, Basel, Switzerland) according to manufacturer’s instructions. Results were analyzed using the ∆∆C_T method normalized to S7 housekeeping gene.
One-step quantitative RT-PCR for SFV was used for relative quantification with efficiency correction using the LightCycler 480 software (version 1.5.1.62; Roche, Basel, Switzerland), specific primers (Supplementary Table S2), SYBR Green master mix (QuantiTect SYBR Green RT-PCR Kit, Qiagen, Germany) and a LightCycler 480 (Roche, Basel, Switzerland) according to manufacturer’s instructions. Standard curves were created using serial dilutions of purified PCR products (SFV and S7 as reference).

First-strand complementary DNA was synthesized using 1.0 μg of total RNA, oligo dT primer, and Transcriptor Reverse Transcriptase (Roche, Penzberg, Germany). qRT-PCR analysis was performed in LightCycler 480 SYBR Green I Master mix (Roche, Germany) on a Roche 480 LightCycler^® (Basel, Switzerland). Complementary DNA (1:20 dilution) was used as a template (5 μL) in a 20 μL reaction volume. For each sample type, there were four to six technical replicates. PCR cycles were as follows: initial denaturation at 95 °C for 5 min, followed by 45 cycles of 95 °C for 10 s, 65 °C for 15 s, and 72 °C for 12 s, and a final melt curve analysis to determine the amplification of a single product. Primers were designed using Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/Primer-Blast/) to span an intron if possible, with 100–150 bp product size (S1 Table). MDP0000336547 was selected as the reference gene [17 ]. Primer efficiencies and relative expression levels of targets were calculated using the Roche 480 Light Cycler software E-Method [18 ].

Amplicons resulting from the MIP capture protocol in Fig. 4 before NGS library preparation were used as templates and diluted 1:10,000 for high-resolution melt analysis. This was compared to concentrations of genomic DNA which were used as an input to the MIP protocol. HPLC purified primers for F. tularensis gyrA (forward 5′-CGGTAAATATCACCCTCATGGAG and reverse 5′- AGGTTGTGCCATTCTGACAATAGTAT) and parE (forward 5′-CTTACATGGCATTTTGAAACTGGAC and reverse 5′- CAGCTTCTAGTTTATGGTCAAGATAGCC) were utilized4 (link). Reaction conditions included 1X Lightcycler 480 High Resolution Melting Master Mix (Roche Diagnostics, Indianapolis, IN), 0.4 μM forward and reverse primers, and MgCl₂ to a final concentration of 3 mM. Reactions were performed on a Roche 480 Lightcycler (Roche Diagnostics, Indianapolis, IN) with thermocycling conditions consisting of a pre-incubation cycle of 95 °C for 10 min, a 45 cycle amplification step of 95 °C for 10 sec, 60 °C for 10 sec, and 72 °C for 10 sec with a fluorescence reading taken at the end of each 72 °C step, and a high-resolution melt step of 95 °C for 1 min, 45 °C for 1 min, and melt curve from 65 °C to 95 °C with 25 fluorescent readings taken per 1 °C temperature change. Values were generated using the melt curve genotyping analysis with the integrated Roche LightCycler 480 software version 1.5.1.

Cells were harvested from each cyclophane complex treatment at time points of 8 and 24 h. The RNeasy Mini Kit (Qiagen-SABiosciences, Frederick, MD, USA), which included a step to remove genomic DNA, and the RT² First Strand Kit (Qiagen-SABiosciences, Frederick, MD, USA) was used for synthesizing cDNA by reverse transcription. The RT² Profiler™ PCR Array Human Innate and Adaptive Immune Responses, specific for 84 immune genes (catalog PAHS-052Z; Qiagen-SABiosciences, Frederick, MD, USA) was used to query immune responsive gene expression. This method consists of a quantitative PCR reaction with SYBR-green detection, where the cDNA is loaded into 96-well PCR array plates. Each plate has specific primers for the 84 immune genes, plus housekeeping genes and experimental controls. The protocol and recommendations of the manufacturer were followed thoroughly.
The experiment was performed on a Roche LightCycler 480 (Roche, Indianapolis, IN, USA) thermal cycler and the amplification conditions were: one cycle of 95 °C for 10 min, then 45 cycles of 95 °C for 15 s, and 60 °C for 1 min. Raw data were acquired and analyzed using the Roche LightCycler 480 software, including the calculation of C_t (threshold cycle) values, which are proportional to the abundance of the cDNA of interest (Romoser et al., 2011 (link)).

Custom TaqMan^® SNP Genotyping Assays (Life Technologies, Carlsbad, CA, USA) were developed for each of the three target site mutations (codons 989, 1016, 1534) and were run on the Roche LightCycler^® 480 [28 (link)]. Endpoint genotyping was conducted using the Roche LightCycler^® 480 Software, version 1.5.1.62.
One hundred thirty mosquito samples were screened from each of the two districts of Jeddah; 117 dead and 121 surviving mosquitoes were screened from insecticide bioassays (Table 2).

Colony, field collected mosquitoes from BGS traps, larval samples from field containers, and samples from maternal transmission were screened for
Wolbachia using Taqman qPCR on a Roche LightCycler 480 using an internally controlled qualitative assay for the presence or absence of
Wolbachia as previously described (
Dar
et al., 2008;
O’Neill
et al., 2019;
Yeap
et al., 2014). TM513 primers and probe were used for Tri Nguyen samples to keep consistency with primary results and WSP primers and probe was used for Vinh Luong ward to reduce the possible effect of gene copy number variation in comparison with WS0513 gene. The qPCR cycling program consisted of a denaturation at 95°C for 5 min followed by 45 cycles of PCR (denaturation at 95°C for 10 sec, annealing at 60°C for 15 sec, and extension at 72°C for 1 sec with single acquisition) followed by a cooling down step at 40°C for 10 sec. Using the data generated for the presence-absence of
Wolbachia, the relative density of
Wolbachia per cell was calculated using the Advanced Relative Quantification (∆∆C
_T- Method) function within the Roche LightCycler 480 Software.