Ncm460

Manufactured by Thermo Fisher Scientific

Visit Supplier

Sourced in United States, China

About the product

The NCM460 is a lab equipment product manufactured by Thermo Fisher Scientific. It is a cell culture medium designed to support the growth and maintenance of normal human colonic mucosal (NCM) cells. The product provides a standardized and optimized solution for culturing these specific cell types in a controlled laboratory environment.

Automatically generated - may contain errors

Get Technical Specifications Find protocols

Lab products found in correlation

Check compatibility

Market Availability & Pricing

Is this product still available?

Get pricing insights and sourcing options

Spelling variants of this product

NCM460 cells (1 citations) DMEM (NCM460) (1 citations)

The spelling variants listed below correspond to different ways the product may be referred to in scientific literature.
These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.

116 protocols using ncm460

Overexpression and Knockdown of ABHD11-AS1 in Colon Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human normal colon epithelial cell line NCM460 (cat. no. CL0393) and four colon cancer cell lines, HCT116 (cat. no. CL0125), HT29 (cat. no. CL0163), SW480 (cat. no. CL0303) and SW620 (cat. no. CL0305), were obtained from Hunan Fenghui Biotechnology. All cells were identified by STR. The culture conditions were as previously described (12 (link)). NCM460 and HCT116 cells were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (ZETA LIFE, Inc.). HT29, SW480 and SW620 cells were cultured in RPMI-1640 (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. ABHD11-AS1 overexpression plasmid and three ABHD11-AS1 short hairpin (sh)RNAs (sh-ABHD11-AS1-1, sh-ABHD11-AS1-2 and sh-ABHD11-AS1-3) were obtained from Shanghai GeneChem Co., Ltd. (Table SI). HCT116 and SW620 cells were transfected with 2 μg plasmid (ABHD11-AS1: GV658 vector, pcDNA3.1-C MV-3flag-EF1A-zsGreen-sv40-puromycin; the negative vector: GV658 vector, pcDNA3.1; shRNA: GV102 vector; the negative control sequence was 5′-TTCTCCGAACGTGTCACGT-3′.) (Shanghai GeneChem Co., Ltd.) using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 6-8 h before changing the medium. The subsequent experiments were carried out 48 h after transfection. The effects of overexpression and knockdown were detected by quantitative (q)PCR.

Tan S., Li S., Xia L., Jiang X., Ren Z., Peng Q., Peng M., Yang W., Xu X., Oyang L., Shen M., Wang J., Li H., Wu N., Tang Y., Liao Q., Lin J, & Zhou Y. (2025). Long non-coding RNA ABHD11-AS1 inhibits colorectal cancer progression through interacting with EGFR to suppress the EGFR/ERK signaling pathway. International Journal of Oncology, 66(3), 20.

+ Open protocol

+ Expand

Bacterial Infection of Colon Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Colon cancer cell lines DLD-1 and HT-29 were acquired from Cell Bank, China Academy of Sciences (Shanghai, China). Immortalized human colonic epithelial cell NCM460 was kindly provided by BeNa Culture Collection (Henan, China). DLD-1, HT-29, and NCM460 cells were cultured in RPMI-1640, McCoy's 5A, and DMEM (Gibco, Thermo Fisher Scientific), respectively. Each media contained 10% (v/v) fetal bovine serum (FBS), and the cells were maintained in a humidified incubator at 37 °C with 5% CO₂. Each cell line was recently authenticated by STR profiling and tested for mycoplasma contamination. For the bacterial infection study, cells were infected with S. moorei anaerobically or E. coli MG1655 at MOI (multiplicity of infection) of 100 for 2 h every 24 hours. Following incubation, then removed the bacteria and the bacteria-containing medium was substituted by a cell culture medium that contained 10% FBS, 20 µg/mL gentamycin, and 1% penicillin-streptomycin (PS) continue to culture cells in the carbon dioxide incubator. Cells were co-cultured with bacteria three times within 72 hours.

Chen Y., Qin Y., Fan T., Qiu C., Zhang Y., Dai M., Zhou Y., Sun Q., Guo Y., Hao Y, & Jiang Y. (2025). Solobacterium moorei promotes tumor progression via the Integrin α2/β1-PI3K-AKT-mTOR-C-myc signaling pathway in colorectal cancer. International Journal of Biological Sciences, 21(4), 1497-1512.

+ Open protocol

+ Expand

Culturing Colorectal Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CRC cell lines (HCT116, DLD-1, HCT8, SW480, and SW620) purchased from American Type Culture Collection (Manassas, Virginia, USA) were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% foetal bovine serum (FBS) and 1% Penicillin/Streptomycin at an incubator with 37℃ and 5% CO₂. Human normal colonic epithelial cell line NCM460 cultured in DMEM/F12 (#11320033; Gibco, Waltham, MA, USA) was used as the control group of CRC cell lines, and the culture environment of NCM460 cells was consistent with that of CRC cell lines.

Li L., Zhang R, & Li Y. (2025). Up-regulation of m6A writer METTL14 inhibits tumorigenesis by suppressing glycolysis in colorectal cancer. BMC Cancer, 25, 305.

+ Open protocol

+ Expand

Culturing Human Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK-293 cell lines, CRC cell lines (HCT-116, SW480) and human normal colonic epithelial cells (NCM460) were all purchased from the American Tissue Culture and Preservation Center (ATCC). NCM460 were cultured in RPMI-1640 (Gibco, USA) complete medium supplemented with 10% fetal bovine serum and 1% penicillin streptomycin. HEK-293, SW480 and HCT116 cells were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum and 1% penicillin streptomycin. The cells were cultured at 37 °C in a 5% CO₂ incubator.

Chen S., Yang J., Qi G., Zhao J., Chen Y., Guo X., Zhang J., Gan J., Jian Z, & Jin J. (2025). Evodiamine inhibits colorectal cancer cell stemness by disturbing ubiquitin specific protease 4 mediated SOX9 stabilization. Discover Oncology, 16, 403.

+ Open protocol

+ Expand

Culturing Intestinal and Colorectal Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The normal intestinal epithelium cell line NCM460 was obtained from Incell Corporation, LLC (www.incell.com) and the CRC cell line HCT116/HCT8 was purchased from the American Type Culture Collection (Rockville, MD, USA). NCM460 cells were cultured in 1640 medium (C11875500BT, Gibco, USA) supplemented with 10% fetal bovine serum (ST30-3302, PAN, Germany) and 1% streptomycin/penicillin (C0222, Beyotime, China). HCT116/HCT8 cells were cultured in DMEM medium (C11995500BT, Gibco) containing 10% fetal bovine serum (ST30-3302, PAN) and 1% streptomycin/penicillin (C0222, Beyotime). And all cells were maintained at 37℃ in a humidified incubator with 5% CO₂.

Ouyang X.M., Lin J.H., Lin Y., Zhao X.L., Huo Y., Liang L.Y., Huang Y.D., Xie G.J., Mi P., Ye Z.Y, & Guleng B. (2025). The SERPINB4 gene mutation identified in twin patients with Crohn’s disease impaires the intestinal epithelial cell functions. Scientific Reports, 15, 2638.

+ Open protocol

+ Expand

Culturing CRC and Normal Colonic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two commonly used CRC cell lines (HT-29, HCT116) and one human normal colonic epithelial cell line NCM460 were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). HT-29 was highly differentiated, and HCT116 was CRC cell line in situ. The human umbilical vein endothelial cells (HUVECs) were also obtained from ATCC. HT-29 cells were routinely cultured in McCoy’s 5A medium (Gibco, Carlsbad, CA, USA), NCM 460 were grown in RPMI 1640 medium (Gibco, Carlsbad, CA, USA), and the other two cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, Carlsbad, CA, USA), both of which contained 10% foetal bovine serum (FBS). All the cells were maintained at 37 ℃ in a humidified 5% CO₂ incubator.

Zhang L., Deng M., Liu J., Zhang J., Wang F, & Yu W. (2024). The pathogenicity of vancomycin-resistant Enterococcus faecalis to colon cancer cells. BMC Infectious Diseases, 24, 230.

+ Open protocol

+ Expand

Investigating HOXC6 Knockdown in Colon Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human colon cancer cell lines SW480, SW620 and Human normal colon epithelial cells NCM460 were obtained from BNCC (Beijing, China). SW480, SW620 and NCM460 cells were cultured in DMEM F12 with 10 % FBS (Gibco, Thermo Fisher, USA). Cells were grown at 37 °C in a humidified environment containing 5 % CO2. The target sequences of NPM1 siRNA were shown in Table 1.Table 1

The target sequences for NPM1 siRNA.

Table 1

Gene	target sequence (5′−3′)
si HOXC6#1	CCGTATGACTATGGATCTAATTC
si HOXC6#2	GACTATGGATCTAATTCCTTTTA

Chen J., Wang Z., Zhu Q., Ren S., Xu Y., Wang G, & Zhou L. (2024). Comprehensive analysis and experimental verification of the mechanism of action of T cell-mediated tumor-killing related genes in Colon adenocarcinoma. Translational Oncology, 43, 101918.

+ Open protocol

+ Expand

Colon Cancer Cell Lines: SLC35A3 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human colon epithelial cells NCM460 and CRC cell lines (including HCT116, HT29, and SW620) were purchased from Procell Life Science & Technology Co., Ltd. (Procell, Wuhan, China). NCM460 and SW620 cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin–streptomycin (100 U/mL penicillin and 100 μg/mL streptomycin). HCT116 and HT29 cells were cultured in RPMI-1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin/streptomycin (Gibco). SLC35A3 overexpression models were established in HCT116 and SW620 cells using the pcDNA3.1( +)-SLC35A3 plasmid with the assistance of Lipofectamine 8000 transfection reagent (Beyotime). Empty vector was used as a negative control. After 48 h of cell culture, the corresponding phenotypic experiments were performed. The pcDNA3.1( +) plasmid containing SLC35A3 coding sequence was constructed by GenePharma (Shanghai, China). Primers for SLC35A3 (forward, 5′-GCTTGGTACCGAGCTCGGATCCG-3′, reverse, 5′-TGCTGGATATCT GCAGAATTCCTATGCTTTAGTGGGATTTCCTGCAGG-3′) were provided by GenePharma.

Lu S., Sun X., Tang H., Yu J., Wang B., Xiao R., Qu J., Sun F., Deng Z., Li C., Yang P., Yang Z, & Rao B. (2024). Colorectal cancer with low SLC35A3 is associated with immune infiltrates and poor prognosis. Scientific Reports, 14, 329.

+ Open protocol

+ Expand

Culturing Human Colon Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human CRC cell lines HCT116, SW620, DLD-1, and HT29 [purchased from the American Tissue Culture Collection (ATCC; Manassas, VA, USA)], SW480 [purchased from the Korean Cell Line Bank (KCLB; Korea)], and a normal human colon mucosal epithelial cell line NCM460 (purchased from the ATCC) were cultured in Dulbecco’s modified Eagle medium/high glucose (DMEM/high glucose; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT, USA) and 1% antibiotic–antimycotic (Gibco) and maintained at 37 °C in a humidified incubator containing 5% CO₂.

Kim S.Y., Kim J., Kim H., Chang Y.T., Kwon H.Y., Lee J.L., Yoon Y.S., Kim C.W., Hong S.M., Shin J.H., Hong S.W., Hwang S.W., Ye B.D., Byeon J.S., Yang S.K., Son B.H, & Myung S.J. (2024). Fluorescence-guided tumor visualization of colorectal cancer using tumor-initiating probe yellow in preclinical models. Scientific Reports, 14, 26946.

+ Open protocol

+ Expand

Culturing Intestinal and Colon Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

NCM460 human intestinal epithelial cells and CT26 murine colon carcinoma cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). NCM460 and CT26 cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 culture medium (11875085, Gibco, NY, USA) supplemented with 10% fetal bovine serum (10099158, Gibco, NY, USA). The culture conditions included a humidified atmosphere containing 5% CO₂, with a constant temperature maintained at 37 °C.

Yu Z.L., Gao R.Y., Lv C., Geng X.L., Ren Y.J., Zhang J., Ren J.Y., Wang H., Ai F.B., Wang Z.Y., Zhang B.B., Liu D.H., Yue B., Wang Z.T, & Dou W. (2024). Notoginsenoside R1 promotes Lgr5+ stem cell and epithelium renovation in colitis mice via activating Wnt/β-Catenin signaling. Acta Pharmacologica Sinica, 45(7), 1451-1465.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!