Total RNA was extracted using TrizolTM reagent (DP424, Tiangen Biotech, Beijing, CHN). cDNA for each sample was synthesized with the use of a reverse transcription kit (Thermo Fisher Scientific, MA, US). Real-time PCR was performed using SYBR® Green Real-Time PCR Master Mix (Roche, Germany) analyzed by a CFX96 TouchTM Deep Well Real-Time PCR Detection System (Bio-Rad Laboratories, CA, US) and. The primers we used are listed in Supplemental Table 1
Trizol reagent
Manufactured by Tiangen Biotech
Sourced in China
TRIzol reagent is a guanidinium-based solution used for the isolation and purification of total RNA from various biological samples, including cells, tissues, and other sources. It is a single-phase reagent that effectively lyses cells and separates RNA, DNA, and proteins during the extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (45 mentions)
Fastquant rt kit, by Tiangen Biotech (31 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (29 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (28 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (28 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (23 mentions)
Primescript rt master mix, by Takara Bio (21 mentions)
Sybr premix ex taq, by Takara Bio (20 mentions)
Dnase 1, by Takara Bio (17 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (15 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (12 mentions)
Superreal premix plus sybr green, by Tiangen Biotech (12 mentions)
Superreal premix plus, by Tiangen Biotech (12 mentions)
Tb green premix ex taq 2, by Takara Bio (11 mentions)
Fastking rt kit, by Tiangen Biotech (11 mentions)
Hiscript 3 rt supermix, by Vazyme (10 mentions)
Rnase free dnase 1, by Takara Bio (10 mentions)
Reverse transcription kit, by Takara Bio (10 mentions)
Fastquant rt kit with gdnase, by Tiangen Biotech (10 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (10 mentions)
771 protocols using trizol reagent
1
RNA Extraction and qPCR Analysis
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lumbar enlargements (n=3 for each group at each time point) were deeply anesthetized and were rapidly harvested on ice, homogenized and treated with TrizolTM Reagent (DP424, Tiangen Biotech, Beijing, CHN) to extract the total RNA. The cDNA for each sample was synthesized using a reverse transcription kit (KR118, Tiangen Biotech, Beijing, CHN). RT-PCR was performed with SYBR®Green Real-Time PCR Master Mixes (E096, Novo, Shanghai, CHN) using using CFX96 TouchTM Deep Well Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, US). All the primers are listed in Table 1 . The cycling conditions were set as 95°C for 1 min, followed by 40 cycles of 95°C for 20s→50-60°C (depending on the primers) for 20s→72°C for 30s. GAPDH was used to standardize each gene expression. Data of Cycle Threshold (CT) in each sample then were processed using the 2−ΔΔCt method.
Primers for Each Gene for PCR Analysis
| Primer | Forward | Reverse |
|---|---|---|
| CATCAGCTCCTGTCTGGTTT | CTCTCTGCAGCCTGTGTATTT | |
| ACAGGAATTGTGTCCACGGG | AAGGCCTGGGTCAGGGATAA | |
| TTGCTCTGTGAAGGGAATGG | GGCTCTGAGGAGTAGACAATAAAG | |
| TGGTGTGGTGGCAGAGGTCCA | ACTGCCAGACTGTGGTCTCCACC | |
| TGTCATCCTGCTCTTCTTTCTC | TCTGTGGTGTTCTTCGTTGC | |
| CTGAATGTCAGAGTCCGTGAA | CAGACTGGACTTCTGCTGATAC | |
| CCTTACGGACAGCTTACCTT | CCAGGTGAATTGCTGGAGAA | |
| TGCCACTCAGAAGACTGTGG | TTCAGCTCTGGGATGACCTT |
3
RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using Trizol reagent (TIANGEN Biotech, Beijing). Five hundred nanograms of purified RNA was reverse transcribed using the Hifair 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Y Cat. ID:KR116, TIANGEN Biotech). PCR samples were prepared with diluted cDNA (1:30), 5 μl SYBR Green PCR master mix (TIANGEN Biotech), .2 μM each of the forward and reverse primers (Table S2) in a total volume of 10 μl. Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) was performed by using an Analytikjena qPCRsoft 4.0 (Germany). The relative expression level of the target gene was calculated by using the 2−ΔΔCT method and graphed as fold change (2−ΔΔCT) from control.
4
Total RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Tiangen Biotech Co., Ltd., Beijing, China) and then quantified by a NanoDrop 1000. Two microgram of RNA was reverse-transcribed to cDNA and amplified using 2×LC480 SYBR-green IMaster Mix (Roche) with a LightCycler 480 instrument (Roche Diagnostics, China). Primers were designed and synthesized by Invitrogen Corporation (China). For data analysis, target gene transcripts were quantified in comparison to β-actin as a reference.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Tiangen, Beijing, China). A total of 1 μg total RNA was reversely transcribed into complementary DNA (cDNA) with PrimeScript RT reagent kit (TaKaRa, Shiga, Japan) using oligo(dT) primer at 42°C for 1 h, and 2 μL the reverse transcription reaction mix was amplified by PCR with denaturation at 95°C for 2 min, followed by 50 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min. Then, qRT-PCR assay was carried out using SYBR Green PCR Kit (TaKaRa) with the 7300 Real-Time PCR System (Applied Biosystems, Carlsbad, USA). β-Actin was used as an internal control. The sequences of the qPCR primers used are listed in Table 2. Relative gene expression levels were calculated using the 2 -ΔΔCT method, with data presented as fold changes relative to the control, which was set as 1.
6
Serum RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from serum samples with TRIzol Reagent (DP405-02, TIANGEN Biotech, Beijing, China), after which cDNA was synthesized with reverse transcriptase (RR047B, Takara, Beijing, China) in accordance with the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) was performed using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus, TaKaRa, Japan) to detect the mRNA levels of NGAL and MMP9. Reaction parameters were as follows: 95oC for 30 s, followed by 45 cycles at 95oC for 5 s and 60oC for 40 s. Data were collected and analyzed with GraphPad and SPSS 25.0. The expression of genes within a sample was normalized to GAPDH expression by employing the 2ΔΔCt method. The primers used in the present study were as follows: NGAL (Forward: ACAAAGACCCGCAAAAGATG; Reverse: TTGGGACAGGGAAGACGAT), and MMP9 (Forward: GAGCACGGAGACGGGTATC; Reverse: ACTCGTCATCGTCGAAATGG).
7
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from plants with TRIzol reagent (Tiangen), and the first-strand cDNA was reverse transcribed from 2 μg of small RNA using the TransScript II First-Strand cDNA Synthesis SuperMix (Transgen) kit. qRT-PCR analysis was performed with SYBR FAST qPCR kits (KAPA). Primers for qRT-PCR are listed in Supplemental Table 2.
8
Total RNA Isolation by TRIzol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA samples were isolated by TRIzol reagent (TIANGEN BIOTECH, Beijing). The RNA purity and concentration were then measured using a NanoPhotometer spectrophotometer (IMPLEN, CA, United States).
9
Transcriptome Analysis of Honey Bee Larvae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of each sample was extracted using TRIzol reagent (Tiangen, Beijing). The concentration and integrity of RNA were assessed using Qubit 3.0 Fluorometer and Agilent 2100 bioanalyzer. Each group of queen and worker larvae had 3 biological replicates.
Total mRNA of each sample was enriched using oligo (dT) magnetic beads. First-strand cDNA was synthesized by random hexamers, and the second-strand cDNA was synthesized in DNA polymerase I system using dNTPs and RNaseH. Afterwards, cDNA was subjected to end repair and performed with poly(A) tail and ligation sequencing adapter. 200–350 bp cDNA were selected by AMPure XP beads, and then were PCR amplified and purified by AMPure XP beads. Library quality was evaluated using Agilent 2100 bioanalyzer and qRT-PCR. Totally 18 libraries were sequenced by an Illumina NovaSeq 6000 platform. This was performed by Wuhan Benagen Tech Solutions Company Limited also.
Total mRNA of each sample was enriched using oligo (dT) magnetic beads. First-strand cDNA was synthesized by random hexamers, and the second-strand cDNA was synthesized in DNA polymerase I system using dNTPs and RNaseH. Afterwards, cDNA was subjected to end repair and performed with poly(A) tail and ligation sequencing adapter. 200–350 bp cDNA were selected by AMPure XP beads, and then were PCR amplified and purified by AMPure XP beads. Library quality was evaluated using Agilent 2100 bioanalyzer and qRT-PCR. Totally 18 libraries were sequenced by an Illumina NovaSeq 6000 platform. This was performed by Wuhan Benagen Tech Solutions Company Limited also.
10
Quantification of miRNA in Extracellular Vesicles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The same amount of Caenorhabditis elegans cel-39-3p miRNA was spiked into each sEV sample as an external calibration for RNA extraction, RT, and miRNA amplification. Total RNAs were extracted from cells using the Trizol reagent (Tiangen; cat. no. DP421). cDNAs were synthesized using the first-strand cDNA synthesis kit (Tiangen; cat. no. KR118). The relative expression of mRNA was measured using the SuperReal PreMix Color (SYBR Green) qRT-PCR Kit (Tiangen; cat. no. FP215). miRNAs in exosomes, cells, and tissues were extracted using the miRNeasy Mini Kit (QIAGEN; cat. no. 217184), according to the manufacturer’s protocols. Then, RNA was reverse transcribed to cDNA following the kit protocol (Tiangen; cat. no. KR211). The miRNA level was detected using the miRcute Plus miRNA qPCR Kit (SYBR Green) (Tiangen; cat. no. FP411). Data were normalized to levels of GAPDH (mRNA), U6 (cellular and tissue miRNA), or cel-39 (exosomal miRNAs) and analyzed by the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!