5X All-In-One RT MasterMix
The 5X All-In-One RT MasterMix is a ready-to-use solution for reverse transcription and subsequent real-time PCR amplification. It contains all the necessary components for both reactions in a single tube.
Lab products found in correlation
285 protocols using 5X All-In-One RT MasterMix
Plant RNA Extraction and Gene Expression Analysis
Comprehensive Stem Cell Characterization
Investigating LEF-10 Aggregation and Late Gene Transcription
Total RNA Extraction and cDNA Synthesis
Quantitative PCR (qPCR) Analysis of Gene Expression
RNA Extraction and qRT-PCR Analysis of miRNA and mRNA
Quantification of DNA Methyltransferase Expression
β-Actin: GGCTGTATTCCCCTCCATCG (F); CCAGTTGGTAACAATGCCATGT (R);
Dnmt1: ATCCTGTGAAAGAGAACCCTGT (F);
CCGATGCGATAGGGCTCTG (R);
Dnmt3b: AGCGGGTATGAGGAGTGCAT (F);
GGGAGCATCCTTCGTGTCTG (R)
Potato Plant Immune Response to Phytophthora
Quantifying Gene Expression in Human Endometrial Cells
Quantitative Gene Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!