Chemidoc system
The ChemiDoc system is a compact imaging system designed for the detection and analysis of chemiluminescent, fluorescent, and colorimetric signals in life science applications. It provides a versatile platform for various imaging techniques, including Western blotting, gel documentation, and multiplex protein detection.
Lab products found in correlation
1 582 protocols using chemidoc system
Western Blot Analysis of Neurocan and Fibronectin
Fly Protein Extraction and Western Blot
Corneal Opacity Assessment Protocol
Quantifying Peroxiredoxin Protein Levels
Primer Design for DNA Repair Genes
Primer characteristics according to Primer-BLAST.
β–Actin | F | TTCTACAATGAGCTGCGTGTG | α1, 2, 9, 1, 11, 5, 10, 3, 8, 4, 6, like 2, X1. | 122 pb | 60 |
Mt−1 | F | TCTCCTTGCCTCGAAATGGAC | Mt−1X, Mt−1E, Mt−1E “like”, Mt−1E V2, Mt−1A, Mt-1M, Mt-1F, Mt-1F V1 | 151 pb | 59 |
OGG1 | F | ACTCCCACTTCCAAGAGGTG | X8, X7, X6, X5, X4, X3, X2, X1, 2e, 2c, 2 f, 1b, 1a, 2 h, 2d, 1c, 1e, 1d, 2b, 2a, 2 g. | 165 pb | 58 |
APE1 | F | CAATACTGGTCAGCTCCTTCG | 2, 4, 3, 1. | 88 pb | 53 |
XPD | F | TCTGCCTCTGCCCTATGAT | X2, 1. | 363 pb | 54 |
XPB | F | CCAGGAAGCGGCACTATGAGG | X2, X1, 1, 2, 3. | 171 pb | 53 |
Rad50 | F | CTTATACAGGACCAGCAGGAAC | Rad50 | 686 pb | 58 |
MRE11 | F | CCAGAGAGCCCTTGTACG | X10, X9, X7, X5, X4, X1, X10, X9, X7, X5, X4, X1, 1, 3, 2. | 667 pb | 57 |
Ku70 | F | CCGAGATACAGGCATCTTCCT | X1, 4, 3, 2, 1. | 204 pb | 54 |
Ku80 | F | AGCATAGACTGCATCCGAGC | 1, X1. | 315 pb | 59 |
F, Forward; R, Reverse; pb, base pairs; Tm, Melting temperature (°C). The genes were purchased from Alpha DNA, PROBIOTEK.
Western Blot Analysis Protocol
Western Blot Analysis of BMDMs/BMDCs
Western Blot Analysis of Synaptic Proteins
Analysis of Proteins in NPC-NS Cells
Western Blot Protein Detection
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!