The MassARRAY platform is a highly sensitive and accurate analytical instrument used for the detection and quantification of specific nucleic acid sequences. It employs the principle of mass spectrometry to provide precise and reliable results for a wide range of applications, including genetic analysis, molecular diagnostics, and research.
The MassARRAY System is officially listed and commercialized by Agena Bioscience. It is available in 96- and 384-well plate formats through authorized distributors. While specific current pricing is not publicly disclosed, historical data indicates that the 96-well format was previously priced at $240,000, and the 384-well format at $375,000.
Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.
To extract genomic DNA, the samples were subjected to digestion with proteinase K, followed by phenol–chloroform extraction. We selected six common TIMP3 SNPs from the Han Chinese population using Beijing HapMap data. The allelic exchange, global mutant allele frequency (MAF), and the gene’s polymorphism location of TIMP3 are shown in Table 1. The somatic mutation was performed by Agena MassARRAY platform with iPLEX reagent chemistry (Agena, San Diego, CA, USA). The specific PCR primer and extension primer sequences of TIMP3 rs715572, TIMP3 rs2234921, TIMP3 rs8136803, TIMP3 rs9609643, TIMP3 rs9619311, and TIMP3 rs11547635 were designed with Assay Designer software package (v.4.0) (Supplementary Table S2). Of genomic DNA sample (10 ng/µl), 1 µl was applied to mutiplex PCR reaction in 5-µl volumes containing 1 unit of Taq polymerase, 500 nmol of each PCR primer mix, and 2.5 mM of each dNTP (Agena, PCR accessory and Enzyme kit). Thermocycling was at 94 °C for 4 min followed by 45 cycles of 94 °C for 20 s, 56 °C for 30 s and 72 °C for 1 min, then 72 °C for 3 min. Unincorporated dNTPs were deactivated using 0.3 U of shrimp alkaline phosphatase. The single base extension reaction was using iPLEX Pro enzyme, terminator mix, and extension primer mix, followed by 94 °C for 30 s followed by 40 cycles of 94 °C for 5 s, and five inner cycles of 56 °C for 5 s and 80 °C for 5 s, then 72 °C for 3 min (Agena, iPLEX Pro reagent kit). After the addition of a cation exchange resin to remove residual salt from the reactions, 7 nl of the purified primer extension reaction was loaded onto a matrix pad of a SpectroCHIP (Agena). SpectroCHIPs were analyzed using a MassARRAY Analyzer 4, with the calling by clustering analysis with TYPER 4.0 software. The distribution of all control genotypes obeyed Hardy–Weinberg equilibrium.
The allelic exchange, global mutant allele frequency (MAF), and the gene’s polymorphism location of TIMP3.
TIMP3
Allelic Exchange
Global MAF
Gene’s Polymorphism Location
rs715572
G > A
A = 0.216515
32,838,944
rs2234921
A > G
G = 0.36649
32,801,088
rs8136803
G > A, T
T = 0.078006
32,841,125
rs9609643
G > A
A = 0.053910
32,855,072
rs9619311
T > C
C = 0.320978
32,800,707
rs11547635
C > A, T
T = 0.074334
T = 0.112540
32,857,305
The information of all SNP from The Allele Frequency Aggregator (ALFA), rs11547635 also from The Genome Aggregation Database (GnomAD_exome).
Huang C.Y., Chen M.C., Wu C.Y., Lin Y.C., Huang Y.L., Shiue H.S., Pu Y.S, & Hsueh Y.M. (2025). Interaction of tissue inhibitor of metalloproteinase 3 gene polymorphism, blood cadmium and total urinary arsenic levels on clear cell renal cell carcinoma. Scientific Reports, 15, 10267.
In selecting SNPs for analysis, we prioritized those located in the CHRNA3 gene with a minor allele frequency (MAF) exceeding 0.05 in the global population. This criterion was obtained from the 1000 Genomes Project database (GRCh38) and ensures genetic diversity, encompassing a wide range of allelic variations. This, in turn, enhances the statistical power and reliability of our genotyping analysis. Additionally, we referred to previously published articles and randomly selected eight SNPs in CHRNA3, including rs76071148, rs615470, rs660652, rs472054, rs578776, rs3743075, rs8040868, rs4366683 [15 (link),18–22 (link)]. The primer sequences outlined in Table 1 were meticulously designed using the online software, Agena Bioscience Assay Design Suite Version 2.0. Bioengineering (Shanghai Co., Ltd, China) was entrusted with the synthesis of these primers. To ensure precise genotyping of the eight SNPs in CHRNA3, the Agena MassARRAY platform from Agena Bioscience (San Diego, CA, USA) was employed. Furthermore, the Agena Bioscience TYPER software (version 4.0) was utilized for data management, analysis, and accurate interpretation of the genotyping results. These measures combined ensure reliability and precision throughout the genotyping process.
Zheng Y., Zhao J., Liu M., Liu Y., Ding Y, & Xie T. (2025). Investigating the role of eight SNPs in CHRNA3 for COPD susceptibility in the Chinese elderly population. Annals of Medicine, 57(1), 2474726.
We selected five SNPs in CYP2C8 (rs1934953, rs1934951, rs2275620 and rs17110453) and CYP2D6 (rs1065852) for genotyping based on previously published articles [13 (link),15 (link),18 (link),22–26 (link)]. These SNPs were chosen due to their established associations with various diseases and their relevance to drug metabolism, particularly in the context of CYP2C8 and CYP2D6 enzymes, which are known to influence glucose homeostasis and T2DM risk. Additionally, the 1000 Genome Project database indicated that the minor allele frequency (MAF) of all selected SNPs is greater than 0.05 in the global population, ensuring that these variants are sufficiently common to have a potential impact on the studied traits. The primers of polymerase chain reaction (PCR) and single nucleotide extension were designed by the Agena Bioscience Assay Design Suite Version 2.0. We used the Agena MassARRAY platform (Agena Bioscience, San Diego, CA) to genotype five SNPs in CYP2C8 and CYP2D6 following the manufacturer’s instructions [25 (link)]. The Agena Bioscience TYPER software (version 4.0) was used to manage and analyse the genotyping results.
Wei H, & Zhao Q. (2025). CYP2D6 polymorphism rs1065852 significantly increases the risk of type 2 diabetes. Annals of Medicine, 57(1), 2470956.
Genetic Variants Influencing Antineoplastic Toxicity in CRC
2024
A retrospective observational study was carried out in which genetic variants involved in the metabolism of antineoplastic drugs for CRC were analyzed, in a sample of patients diagnosed with CRC in our Center (Consorcio Hospital General Universitario de Valencia, CHGUV). A literature search of publications and recommendations of the aforementioned organizations was performed to identify the variants involved in the metabolism of these agents. A total of 25 genetic variants were selected. The genes selected and their polymorphic variants are detailed in Table 1. The sample was composed of patients >18 years diagnosed with CRC in our Center undergoing anticancer treatments, which completed a year of treatment and follow-up. Patients not undergoing anticancer treatments or refusing to take part in the study were excluded. Study variables included demographics (age at diagnosis, sex, date of birth, and ethnicity); tumor-related data (date of diagnosis, tumor stage, presence/absence of metastases); treatment regimen received; adverse drug reactions (ADRs) and evaluation of response. All data was collected at the date of diagnosis, except for ADRs and the evaluation of response, which were collected one year after diagnosis. ADRs were classified according to the Common Toxicity Criteria of Adverse Events (CTCAE v 4.03) [11 ]. ADRs were categorized as neurotoxicity, gastrointestinal (GI), hematologic, kidney, skin, and hepatic toxicity. ADR severity was also collected and categorized (mild: grade 1 and 2; severe≥3). The oncologists followed the Response Evaluation Criteria In Solid Tumors (RECIST v1.1) [12 (link)]. The project was approved by the Ethics Committee of our Center. The samples collected and analyzed were composed of DNA extracted from whole blood drawn by venous puncture. SNPs were analyzed using the MassArray platform (Agena Bioscience). The results obtained were analyzed using SPSS® version 28.0.1.1. The correlation between SNPs and documented toxicities was assessed using logistic regression, statistical significance and odds ratios. The association between survival and the genotypes expressed in the population was examined using logistic regression for binary variables and Kaplan-Meier plotting. Survival was assessed one year after diagnosis of the neoplasm.
Comes-Raga A., Sendra Gisbert L., Marcaida-Benito G., Aliño Pellicer S.F, & Herrero Cervera M.J. (2024). Pharmacogenetics of colorectal cancer in a third-level hospital in Valencia. Advances in Laboratory Medicine, 5(4), 425-431.
Based on genome-wide association studies, 14 SNP loci that were signi cantly correlated with schizophrenia and which had high-e ciency responses in Asian populations were selected and analyzed (24) . All 14 loci were genotyped using the Agena MassARRAY platform (Agena Bioscience, San Diego, CA, USA).
杨 志., 姚明 顺., 徐 伊., 张 小., 什 元., 王 丽., & 崔 东. (2024). Identification of a predictive model for schizophrenia based on SNPs in a Chinese population.
Surgical (i.e., either incisional or excisional biopsies that required a surgical procedure) and core needle biopsies were processed using standard techniques (fixation in 10% neutral buffered formalin and paraffin-embedding). Once a diagnosis was established in histologic and/or immunohistologic staining profiles, the residual materials in the formalin-fixed paraffin-embedded (FFPE) tissue blocks were used for molecular analysis. When multiple tissue blocks were available, the one with the highest tumour cellularity was chosen, without additional tumour microdissection or enrichment. For each paraffin-embedded block, 3–5 slices of 5 μm were collected using an ultramicrotome (Leica EM UC7, Wetzlar, Germany), always discarding the first slices. DNA extraction from these samples was performed using a Maxwell R 16 FFPE plus Lev DNA Purification Kit (Promega, Madison, WI, USA) following the manufacturer’s recommendations. The DNA samples were re-suspended in DNAse-free water (50 μL). The concentration and quality of DNA samples were quantified with the Nanodrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA), and only samples with a DNA concentration of 50 ng/μL or more that met standard quality criteria were selected for genotyping. The DNA quality criterion used was the ratio of the absorbance at 260 nm divided by the reading at 280 nm. Good-quality DNA has a A260/A280 ratio of 1.8–2.0. Good quality samples were stored at −20 °C in 96 well plates. Genotyping of 20 SNPs was conducted by the Spanish National Genotyping (CeGen-PRB2-ISCIII, www.cegen.org) using the iPlex® Gold chemistry and MassARRAY platform, according to manufacturer’s instructions (Agena Bioscience, San Diego, CA, USA). Genotyping assays were designed on GRCh38 version using the Agena Bioscience MassARRAY Assay Designer 4.0 software (Agena Bioscience, San Diego, CA, USA). The 20 SNPs were genotyped in 2 independent assays. PCR reactions were set up in a 5 µl volume and contained 20 ng of template DNA, 1× PCR buffer, 2 mM MgCl2, 500 µM dNTPs and 1 U/reaction of PCR enzyme. Reagents for PCR were for Agena Bioscience (San Diego, CA, USA). A pool of PCR primers was made at a final concentration of each primer of 100 nM. The thermal cycling conditions for the reaction consisted of an initial denaturation step at 94 °C for 2 min, followed by 45 cycles of 94 °C for 30 s, 56 °C for 30 s and 72 °C for 1 min, followed by a final extension step of 72 °C for 1 min. Unincorporated dTNPs were dephosphorylated using shrimp alkaline phosphatase (SAP), so PCR products were treated with 0.6 U shrimp alkaline phosphatase by incubation at 37 °C for 40 min, followed by enzyme inactivation by heating at 85 °C for 5 min. The iPLEX Gold reactions were set up in a final 9 µl volume and contained 0.222x iPLEX buffer Plus, 0.5x iPLEX termination mix and 0.5x iPLEX enzyme. An extension primer mix was made to give a final concentration of each primer between 0.73 µM and 1.46 µM. The thermal cycling conditions for the reaction included an initial denaturation step at 94 °C for 30 s, followed by 40 cycles of 94 °C for 5 s, with an internal 5 cycles loop at 52 °C for 5 s and 80 °C for 5 s, followed by a final extension step of 72 °C for 3 min. The next step is to desalt the iPLEX Gold reaction products with Clean Resin (Agena Bioscience, San Diego, CA, USA) following the manufacturer’s protocol. The desalted products were dispensed onto a 384 Spectrochip II using an RS1000 Nanodispenser and spectra were acquired using the MA4 (Agena Bioscience, San Diego, CA, USA) mass spectrometer, followed by manual inspection of spectra by trained personnel using MassARRAY Typer software v4.0.26 (Agena Bioscience, San Diego, CA, USA). All assays were performed in 384-well plates, including negative controls and a trio of Coriell samples (Na10861, Na11994 and Na11995) for quality control. Two samples and two SNPs (MMPA-rs17577 and CDKAL1-rs7453577) were discarded because of low reproducibility, and not considered for further analysis. The SNP rs444903, that represent an intergenic region, was not considered for further analysis. Internal controls showed 100% reproducibility and genotyping success. Allele and genotype frequencies for all the SNPs (13 genes and 20 SNPs, see Table 2) were estimated by direct counting; genotype and allele distributions were compared to those provided in 1000 Genomes European populations [22 (link)]. All the genes frequencies examined showed good agreement with Hardy–Weinberg equilibrium.
Gaibar M., Galán M., Romero-Lorca A., Antón B., Malón D., Moreno A., Fernández-Santander A, & Novillo A. (2021). Genetic Variants of ANGPT1, CD39, FGF2 and MMP9 Linked to Clinical Outcome of Bevacizumab Plus Chemotherapy for Metastatic Colorectal Cancer. International Journal of Molecular Sciences, 22(3), 1381.
Five SNPs rs118050317, rs75750647, rs7307242, rs10849390 and rs11610368 were selected from NINJ2 gene based on the minor allele frequency was greater than 0.05 in global population. The whole genome DNA was extracted from 5 ml peripheral blood using GoldMag-Mini whole blood genomic DNA purification kit (GoldMag Co. Ltd. Xi’an City, China). The primers of genotyping were designed by Agena on-line software (https://agenacx.com/online-tools/), the primer of this study were list in Table 2. Agena MassARRAY platform was used to detect the five SNPs in case and control group (Agena Bioscience, SanDiego, CA, USA).
Primers used in this study
SNPs
2nd-PCRP
1st-PCRP
UEP_SEQ
rs118050317
ACGTTGGATGGTGTAGTGATTGACACCTG
ACGTTGGATGACAGGAGCTGGTCATGTTGC
ggggtGCCGATGGGGAAGGATTAG
rs75750647
ACGTTGGATGTGTTCGCTGTGTACTGGATG
ACGTTGGATGCCCCCACAAAATTACAAACC
CTAAAGCAGGGTGGAG
rs7307242
ACGTTGGATGAAATGCTTCTCCTGGAAGTC
ACGTTGGATGGCCCTAGCCTGTTTCTTTAG
CCAGATCACTAGCTCTGA
rs10849390
ACGTTGGATGTCACACAATCTCACAGGGAC
ACGTTGGATGGAAATCAGTACTGCCTGTGC
tcgccCAGGGACAGCCCGCTGCC
rs11610368
ACGTTGGATGTCTGTGACTCCTTGCCAATG
ACGTTGGATGCTCTGCAATGTTACACAGCC
CCTTGCCAATGGATAGAATAGAA
UEP SEQ unextended mini-sequencing primer
Cheng Y., Yang L., Shi G., Chen P., Li L., Fang H, & Chen C. (2021). Ninjurin 2 rs118050317 gene polymorphism and endometrial cancer risk. Cancer Cell International, 21, 1.
Twenty-two variants successfully designed for replication genotyping on the Agena Bioscience MassARRAY® platform. Genotyping was performed at Life and Brain, Bonn, Germany, and the Centre National de Génotypage (CNG), Paris, France. Twenty-one variants were successfully genotyped, with one variant (rs147163004 in ASTN2) failing visual cluster plot inspection. An additional nine variants were successfully genotyped using the Agena Bioscience MassARRAY® platform or Thermo FisherTaqMan® assay at the CNG, Paris, France in a subset of the replication samples N=16,850 (7,755 cases, 9,095 controls).
Sims R., van der Lee S.J., Naj A.C., Bellenguez C., Badarinarayan N., Jakobsdottir J., Kunkle B.W., Boland A., Raybould R., Bis J.C., Martin E.R., Grenier-Boley B., Heilmann-Heimbach S., Chouraki V., Kuzma A.B., Sleegers K., Vronskaya M., Ruiz A., Graham R.R., Olaso R., Hoffmann P., Grove M.L., Vardarajan B.N., Hiltunen M., Nöthen M.M., White C.C., Hamilton-Nelson K.L., Epelbaum J., Maier W., Choi S.H., Beecham G.W., Dulary C., Herms S., Smith A.V., Funk C.C., Derbois C., Forstner A.J., Ahmad S., Li H., Bacq D., Harold D., Satizabal C.L., Valladares O., Squassina A., Thomas R., Brody J.A., Qu L., Sanchez-Juan P., Morgan T., Wolters F.J., Zhao Y., Garcia F.S., Denning N., Fornage M., Malamon J., Naranjo M.C., Majounie E., Mosley T.H., Dombroski B., Wallon D., Lupton M.K., Dupuis J., Whitehead P., Fratiglioni L., Medway C., Jian X., Mukherjee S., Keller L., Brown K., Lin H., Cantwell L.B., Panza F., McGuinness B., Moreno-Grau S., Burgess J.D., Solfrizzi V., Proitsi P., Adams H.H., Allen M., Seripa D., Pastor P., Cupples L.A., Price N.D., Hannequin D., Frank-García A., Levy D., Chakrabarty P., Caffarra P., Giegling I., Beiser A.S., Giedraitis V., Hampel H., Garcia M.E., Wang X., Lannfelt L., Mecocci P., Eiriksdottir G., Crane P.K., Pasquier F., Boccardi V., Henández I., Barber R.C., Scherer M., Tarraga L., Adams P.M., Leber M., Chen Y., Albert M.S., Riedel-Heller S., Emilsson V., Beekly D., Braae A., Schmidt R., Blacker D., Masullo C., Schmidt H., Doody R.S., Spalletta G., Longstreth W J.r., Fairchild T.J., Bossù P., Lopez O.L., Frosch M.P., Sacchinelli E., Ghetti B., Sánchez-Juan P., Yang Q., Huebinger R.M., Jessen F., Li S., Kamboh M.I., Morris J., Sotolongo-Grau O., Katz M.J., Corcoran C., Himali J.J., Keene C.D., Tschanz J., Fitzpatrick A.L., Kukull W.A., Norton M., Aspelund T., Larson E.B., Munger R., Rotter J.I., Lipton R.B., Bullido M.J., Hofman A., Montine T.J., Coto E., Boerwinkle E., Petersen R.C., Alvarez V., Rivadeneira F., Reiman E.M., Gallo M., O’Donnell C.J., Reisch J.S., Bruni A.C., Royall D.R., Dichgans M., Sano M., Galimberti D., St George-Hyslop P., Scarpini E., Tsuang D.W., Mancuso M., Bonuccelli U., Winslow A.R., Daniele A., Wu C.K., Peters O., Nacmias B., Riemenschneider M., Heun R., Brayne C., Rubinsztein D.C., Bras J., Guerreiro R., Hardy J., Al-Chalabi A., Shaw C.E., Collinge J., Mann D., Tsolaki M., Clarimón J., Sussams R., Lovestone S., O’Donovan M.C., Owen M.J., Behrens T.W., Mead S., Goate A.M., Uitterlinden A.G., Holmes C., Cruchaga C., Ingelsson M., Bennett D.A., Powell J., Golde T.E., Graff C., De Jager P.L., Morgan K., Ertekin-Taner N., Combarros O., Psaty B.M., Passmore P., Younkin S.G., Berr C., Gudnason V., Rujescu D., Dickson D.W., Dartigues J.F., DeStefano A.L., Ortega-Cubero S., Hakonarson H., Campion D., Boada M., Kauwe J.“., Farrer L.A., Van Broeckhoven C., Ikram M.A., Jones L., Haines J., Tzourio C., Launer L.J., Escott-Price V., Mayeux R., Deleuze J.F., Amin N., Holmans P.A., Pericak-Vance M.A., Amouyel P., van Duijn C.M., Ramirez A., Wang L.S., Lambert J.C., Seshadri S., Williams J, & Schellenberg G.D. (2017). Rare coding variants in PLCG2, ABI3 and TREM2 implicate microglial-mediated innate immunity in Alzheimer’s disease. Nature genetics, 49(9), 1373-1384.
Corresponding organizations : Cardiff University, Erasmus MC, University of Pennsylvania, Inserm, Institut Pasteur de Lille, Université de Lille, Icelandic Heart Association, Dr. John T. Macdonald Foundation, University of Miami, Commissariat à l'Énergie Atomique et aux Énergies Alternatives, Genoscope, University of Washington, University of Bonn, Framingham Heart Study, Boston University, VIB-UAntwerp Center for Molecular Neurology, University of Antwerp, Fundació ACE, University of Basel, University Hospital of Basel, The University of Texas Health Science Center at Houston, Columbia University, University of Eastern Finland, Kuopio University Hospital, Brigham and Women's Hospital, Université Paris Cité, German Center for Neurodegenerative Diseases, University of Iceland, Institute for Systems Biology, Dublin City University, University of Cagliari, Centro de Investigación Biomédica en Red, Marqués de Valdecilla University Hospital, Universidad de Cantabria, Hospital Universitario de Gran Canaria Doctor Negrín, Brown Foundation, University of Mississippi Medical Center, Université de Rouen Normandie, Centre Hospitalier du Rouvray, QIMR Berghofer Medical Research Institute, King's College London, Karolinska University Hospital, Karolinska Institutet, Stockholm University, Queen's Medical Centre, University of Nottingham, University of Bari Aldo Moro, Queen's University Belfast, Mayo Clinic in Florida, Casa Sollievo della Sofferenza, Istituti di Ricovero e Cura a Carattere Scientifico, University of Perugia, Universidad Autónoma de Madrid, Hospital La Paz Institute for Health Research, Instituto de Salud Carlos III, Biomedical Research Networking Center on Neurodegenerative Diseases, National Heart Lung and Blood Institute, University of Florida, University of Parma, Martin Luther University Halle-Wittenberg, Uppsala University, Sorbonne Université, Pitié-Salpêtrière Hospital, Institut du Cerveau, AXA Research Fund, National Institute on Aging, Centre Hospitalier Universitaire de Lille, University of North Texas, University of North Texas Health Science Center, University Medical Center Hamburg-Eppendorf, Universität Hamburg, The University of Texas Southwestern Medical Center, University of Cologne, Johns Hopkins University, Leipzig University, Medical University of Graz, Massachusetts General Hospital, Harvard University, Università Cattolica del Sacro Cuore, Baylor College of Medicine, Fondazione Santa Lucia, University of Pittsburgh, Indiana University – Purdue University Indianapolis, Washington University in St. Louis, Albert Einstein College of Medicine, Utah State University, Fundació Clínic per a la Recerca Biomèdica, University Hospital Mútua de Terrassa, Mútua Terrassa, Université de Toulouse, Medical University of Lodz, University of Leicester, MRC Prion Unit, University College London, Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, University of Milan, Saarland University, Universitat Autònoma de Barcelona, Hospital de Sant Pau, University of Florence, Don Carlo Gnocchi Foundation, University of Duisburg-Essen, Friedrich-Alexander-Universität Erlangen-Nürnberg, Oasi Maria SS, Trinity College Dublin, VA Ann Arbor Healthcare System, Geriatric Research Education and Clinical Center, University of Michigan–Ann Arbor, University of Wisconsin–Madison, Rush University Medical Center, Banner Sun Health Research Institute, Northwestern University, VA Puget Sound Health Care System, Mayo Clinic, Swedish Medical Center, University of California, San Francisco, Duke University, University of Kansas Medical Center, Icahn School of Medicine at Mount Sinai, USF Health Byrd Alzheimer's Institute, University of South Florida, Fred Hutch Cancer Center, Medical University of South Carolina, University of Southern California, Ralph H. Johnson VA Medical Center, University of California, Irvine, University of California, Davis, Mount Sinai Medical Center, University of Alabama at Birmingham, University of Kentucky, New York University, University of California, San Diego, Emory University, University of California, Los Angeles, Translational Genomics Research Institute, University of Washington Medical Center, Portland VA Medical Center, Oregon Health & Science University, Lou Ruvo Brain Institute, Cleveland Clinic, University of New Mexico, University of Colorado Denver, University of Toronto, Occupational Cancer Research Centre, University of North Carolina at Chapel Hill, KU Leuven, Hôpital Broca, Assistance Publique – Hôpitaux de Paris, Bordeaux Population Health, Université de Bordeaux, Centre National de la Recherche Scientifique, Centre Hospitalier Universitaire de Montpellier, Kaiser Permanente Washington Health Research Institute, The Lundquist Institute, Harbor–UCLA Medical Center, Centro de Biología Molecular Severo Ochoa, Central University Hospital of Asturias, Netherlands Consortium for Healthy Ageing, Alzheimer's Association, University of Arizona, South Texas Veterans Health Care System, The University of Texas Health Science Center at San Antonio, University of Cambridge, University of Pisa, Pfizer (United States), Therapeutics Clinical Research, Texas Tech University, Texas Tech University Health Sciences Center, Charité - Universitätsmedizin Berlin, University of Aveiro, University of Manchester, Aristotle University of Thessaloniki, University of Southampton, University of Oxford, University of Florida Health, Columbia University Irving Medical Center, Hôpital Gui de Chauliac, Université de Montpellier, Complejo Asistencial Universitario de Palencia, Universidad de Navarra, Children's Hospital of Philadelphia, Brigham Young University, Case Western Reserve University
Total DNA was extracted from 200 μL of peripheral blood with QIAsymphony DNA Mini Kit (Qiagen, Hilden, Germany). The genotyping of DNA samples was performed at the Spanish National Genotyping Center (CeGen; http://www.cegen.org/) using Agena Bioscience’s MassARRAY platform (San Diego, CA, USA) and the iPLEX® Gold assay design system [14 (link)]. The genotyping cluster plot is shown in Figure S1.
Jiménez-Sousa M.Á., Gómez-Moreno A.Z., Pineda-Tenor D., Brochado-Kith O., Sánchez-Ruano J.J., Artaza-Varasa T., Gómez-Sanz A., Fernández-Rodríguez A, & Resino S. (2018). The Myeloid-Epithelial-Reproductive Tyrosine Kinase (MERTK) rs4374383 Polymorphism Predicts Progression of Liver Fibrosis in Hepatitis C Virus-Infected Patients: A Longitudinal Study. Journal of Clinical Medicine, 7(12), 473.
Corresponding organizations : Centro Nacional de Microbiologia, Instituto de Salud Carlos III, Hospital Virgen de la Salud, Hospital Regional Universitario de Málaga
Three single nucleotide polymorphisms (SNPs) located at the IL7RA gene [rs987106 (intronic region), rs6897932 (exon 6) and rs3194051 (exon 8)] were evaluated in all patients who met the inclusion criteria regardless of LSM value. Our group has previously analyzed these polymorphisms in HIV-coinfected patients in two recent papers [27 (link),28 (link)]. These IL7RA polymorphisms are located at a putative regulatory region, but their effects still are unclear. Their minor allelic frequencies were greater than 20% in white Europeans. QIAsymphony DNA Mini Kit (Qiagen, Hilden, Germany) was used to extract DNA from 200μl of peripheral blood. The Spanish National Genotyping Center (CeGen; http://www.cegen.org/) genotyped the samples by Agena Bioscience’s MassARRAY platform (San Diego, CA, USA) using the iPLEX® Gold assay design system. The 1000 Genomes Project website (http://www.1000genomes.org/home) were used to obtain the frequencies of alleles and genotypes represented in the general population. This database contains a broad representation of common human genetic variation from multiple populations [33 (link)], including the Iberian population in Spain (IBS) and Utah residents with Northern and Western European ancestry (CEU), which were included in the study as a comparative control.
Jiménez-Sousa M.Á., Gómez-Moreno A.Z., Pineda-Tenor D., Medrano L.M., Sánchez-Ruano J.J., Fernández-Rodríguez A., Artaza-Varasa T., Saura-Montalbán J., Vázquez-Morón S., Ryan P, & Resino S. (2018). The IL7RA rs6897932 polymorphism is associated with progression of liver fibrosis in patients with chronic hepatitis C: Repeated measurements design. PLoS ONE, 13(5), e0197115.
Corresponding organizations : Instituto de Salud Carlos III, Centro Nacional de Microbiologia, Hospital Virgen de la Salud, Hospital Universitario de Fuenlabrada, Universidad Complutense de Madrid, Hospital General Universitario Gregorio Marañón, Hospital Universitario Infanta Leonor
The spelling variants listed above correspond to different ways the product may be referred to in scientific literature. These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
🧪 Need help with an experiment or choosing lab equipment?
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.