We Dissect Protocols

Hiscript q rt supermix for qpcr

Manufactured by Vazyme
217 citations
Sourced in China, United States
About the product

HiScript Q RT SuperMix for qPCR is a one-step reverse transcription and real-time PCR reagent. It contains a high-performance reverse transcriptase and a hot-start Taq DNA polymerase for efficient cDNA synthesis and real-time PCR amplification.

Automatically generated - may contain errors

Market Availability & Pricing

The HiScript Q RT SuperMix for qPCR (+gDNA wiper) is an officially listed product from Vazyme, available through authorized distributors. Prices for this product typically range from ¥1,150 to ¥1,350.

Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.

Is this product still available?

Get pricing insights and sourcing options

217 protocols using «hiscript q rt supermix for qpcr»

1

Quantifying Gene Expression via qRT-PCR

2025
Total RNA was isolated using the RNA-easy Isolation Reagent (Vazyme, R701-01) following the manufacturer’s instructions, and subsequently reverse-transcribed into cDNA using HiScript Q RT SuperMix for qPCR (Vazyme, R122-01). The qRT-PCR was then conducted to quantify cDNA with Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02). For normalization, 18s rRNA was used as an internal control, and the 2-ΔΔCt method was employed to analyze the relative expression levels of target genes. The primer sequences for the target genes were provided in Additional file 6: Table S1.
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of RNA

2025
Total RNA samples of tissues and cells were extracted by TRIzol reagent (Vazyme, China). RNA samples were reverse transcribed using the HiScript Q RT SuperMix for qPCR (Vazyme, China). Real‐time quantitative PCR (qRT‐PCR) was performed by Hieff qPCR SYBR Green Master Mix (Yeasen, China). The relative RNA level was analyzed by using 2‐ΔΔct method, and β‐actin was used as an internal control. The primer pairs were synthesized by Tsingke Biotech Co., Ltd.
+ Open protocol
+ Expand
3

RNA Extraction and qRT-PCR Analysis

2025
The cells were lysed using an RNA isolator (R401-01; Vazyme), and total mRNA was extracted following the manufacturer’s instructions. HiScript Q RT SuperMix for qPCR (R123-01; Vazyme) was used to reverse transcribe the mRNA according to the manufacturer’s instructions. Detection was performed on an ABI 7300 QuantStudio3 PCR system using the ChamQ SYBR qPCR Master Mix (Q341-02; Vazyme). The sequences are listed in Table S4.
+ Open protocol
+ Expand
4

Quantitative Analysis of pcmfs Gene Expression

2025
Total RNA was extracted using the E.Z.N.A. Plant RNA Kit (Omega Bio-Tek, Norcross, GA, USA) and subsequently converted to cDNA with a reverse transcription kit HiScript Q RT SuperMix for qPCR (Vazyme, Biotech). qPCRs were performed with AceQ qPCR SYBR Green Master Mix (Vazyme, Biotech) and the ABI 7500 Real-Time PCR amplifier (Applied Biosystems, Foster City, CA, USA). β-tubulin gene was used as the internal reference, and qPCR was used to analyze the specific mRNA expression level of the pcmfs gene. The qPCR amplification program was as follows: amplification at 95°C for 3 min, amplification at 95°C for 3 s, amplification at 60°C for 32 s, 40 cycles, and amplification at 72°C for 3 s. The relative gene expression was analyzed according to the 2∆∆CT method. Sequences of the primers used for qPCR are listed in Table S1.
+ Open protocol
+ Expand
5

Total RNA Extraction and RT-PCR Analysis

2025
Total RNA was extracted from cells or tissues using TRIzol reagent according to the manufacturer's instructions (Invitrogen, CA, USA). Reverse transcription (RT) was performed with HiScript Q RT SuperMix for qPCR (Vazyme Biotech Co., Ltd, Nanjing, China). RT‒PCR was performed in triplicate with a SYBR Green PCR Kit (Vazyme Biotech Co., Ltd, Nanjing, China) on an Applied Biosystems 7900HT sequence detection system (Applied Biosystems). The primers used are listed in Supplementary Table 2.
+ Open protocol
+ Expand

Top 5 most cited protocols using «hiscript q rt supermix for qpcr»

1

Quantification of Antiviral Responses in Avian Cells

To quantitate gene expression and IBV replication from IBV-infected CEK cells and chicken embryos, primers and probes specific for chMDA5 [23 (link)], chIFN-β [24 (link)], chIFN-λ, chMx [25 (link)] and IBV 5′-UTR (Table 1) were used for real-time PCR as previously described [26 (link)]. Briefly, RNA was extracted using an RNA extraction kit (MiniBEST Universal RNA Extraction Kit, Takara, China) according to the manufacturer’s instructions. A total of 1 μg of RNA was then reverse transcribed to cDNA using a reverse transcription kit (HiScript Q RT SuperMix for qPCR, Vazyme, China) according to the manufacturer’s instructions, after which the transcribed products were diluted and stored at −20 °C. Gene expression was quantitated using a LightCycler 2.0 System (Roche Diagnostics Ltd., Switzerland). The relative expression ratios of the target genes chMDA5, chIFN-β, chIFN-λ and chMx were calculated using the △△Ct method. To assess IBV replication in ovo and in vitro, real-time PCR was performed by absolute quantitation PCR [26 (link)].

SiRNA for silencing as well as primers for plasmid construction and real-time PCR used in this study

PurposeNameSequence(5’ to3’)Accession no.References
Cloning of chMDA5chMDA5-F1AAAGATATCTATGTCGGAGGAGTGCCGA (EcoRV)GU570144.1
chMDA5-R1AATGGATCCCTTCTTTTGTCATC
Cloning of chMDA5chMDA5-F2ACAAAAGAAGGGATCCATTTAGAG (overlap sequence)
chMDA5-R2CTAGTCTAGATTAATCTTCATCACTTGAAGGACAA (XbaI)
Cloning of chTLR3chTLR3-FATAAGAATGCGGCCGCTAAACTAATGGGATGCTCTATTCCTTGCT (NotI)NM_001011691
chTLR3-RAAAGATATCAATCAGCGCACTTTACTATTAGATTTAAG (EcoRV)
Cloning of dgRIG- IdgRIG-I-FGGAATTCC ATGACGGCGGAGGAAAAG (EcoRI)JF804977.1
dgRIG-I-RGAGGATCCTCAAATGGTGGGTACAAGTTGGAC (BamHI)
SilencingSiMDA5GAACGUGAAGAUGUAAAUATT[22 (link)]
SilencingSiTLR3GCAGAUUGUAGUCACCUAATT[22 (link)]
SilencingSiMAVSUACAGGAGGCUUCAAGGAGGUGUCA[22 (link)]
SilencingsiRNA controlAUUACGGGCCAGUAAUCUAT
Real-time PCRchIFN-β FCAGCTCTCACCACCACCTTCTC[24 (link)]
chIFN-β RGGAGGTGGAGCCGTATTCTG
Real-time PCRchβ-actin FCAACACAGTGCTGTCTGGTGGTA[27 (link)]
chβ-actin RATCGTACTCCTGCTTGCTGATCC
Real-time PCRchIFN-λ FTGAGCTGGACCTCACCATCANM_001128496.1
Real-time PCRchIFN-λ RGGGCTGTTGGCACGTCTCT
Real-time PCRchMda5 FTGGAGCTGGGCATCTTTCAG[23 (link)]
chMda5 RGTTCCCACGACTCTCAATAACAGT
Real-time PCRchMx FTTGTCTGGTGTTGCTCTTCCT[25 (link)]
chMx RGCTGTATTTCTGTGTTGCGGTA
Real-time PCRIBV-GL533GCCATGTTGTCACTGTCTATTG[26 (link)]
IBV-GU391GCTTTTGAGCCTAGCGTT
IBV-ProbeFAM-CACCACCAGAACCTGTCACCTC-BHQ

The underlined nucleotides are restriction enzyme sequences. Restriction enzymes are indicated in parentheses

+ Open protocol
+ Expand

Corresponding organizations : Yangzhou University

2

Quantification of TGEV Entry and Binding

Total RNA from IPEC-J2 cells infected with TGEV was extracted using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. The cDNA was generated by reverse transcription using HiScript QRT SuperMix for qPCR (Vazyme) according to the manufacturer's instructions. TGEV entry and binding were assessed by detecting the viral nucleoprotein (N) gene using quantitative RT-PCR with the TaKaRa SYBR Green qPCR Kit (TaKaRa). Primer sequences were as follows: N-F (sense), 5′-CAATTCCCGTGGTCGGAAGA-3′; N-R (antisense), 5′-TTTACGTTGGCCCTTCACCA-3′; GAPDH-F, 5′-TCATCATCTCTGCCCCTTCT-3′; GAPDH-R, 5′-GTCATGAGTCCCTCCACGAT-3′. PCR products were purified using a Gel Extraction Kit (Omega), and cloned into the pJET1.2 vector (Thermo). Plasmids were diluted serially and used as standards for quantitative analysis. The initial copy number of TGEV N gene and GAPDH in each group was calculated using the following formula: X0 = −K log Ct + b, where X0 is the initial copy number, K, Ct, and b refer to the slope rate, cycle threshold, and constant, respectively. Quantitative real-time PCR was performed with the ABI PRISM 7500 Detection System (Applied Biosystems, Foster, USA).
+ Open protocol
+ Expand

Corresponding organizations : Nanjing Agricultural University

3

Differential Expression of API in H. contortus

Eggs, L3, xL3, male and female adult H. contortus were used for the differential expression of API. Total RNA was extracted and cDNA was reverse-transcribed using a HiScript® Q RT SuperMix for qPCR (Vazyme, Nanjing, China) according to the manufacturer’s instructions. Real-time PCR was performed on ABI 7500 Real Time PCR System (Applied Biosystems, New York, USA), using the standard procedure. The reactions and conditions of real time PCR are detailed in Additional file 2: Protocols. The primers for real-time PCR are listed in Additional file 1: Table S2. The amplification efficiencies of target and reference genes were verified and the results are shown in Additional file 3: Figure S1. The transcription levels for API in different life-cycle stages were analyzed by the ABI Prism 7500 software version 2.0.6 (Applied Biosystems, New York, USA) used the comparative Ct (2−ΔΔCt) method [24 (link)]. This experiment was repeated three times.
+ Open protocol
+ Expand

Corresponding organizations : Nanjing Agricultural University

4

Gene Expression and Protein Analysis

Total RNAs were isolated with TRIzol reagent (Invitrogen). Equal amounts of RNA (1 μg) from each sample were used for cDNA synthesis using HiScriptQ RT SuperMix for qPCR (Vazyme, Nanjing, China). qPCR was performed on the ABI StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using GoTaq qPCR Master Mix assay (Promega) and analyzed using StepOne Software v2.1 (Applied Biosystems). 2−ΔCT method was used to calculate gene expression levels. For sample loading control, GAPDH were tested. Primers used for qPCR amplification are available in Table S1.
Sample protein extraction and concentration determination of whole cells were performed as previously described [47 (link)]. Cytoplasmic and nuclear proteins were obtained using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime) according to the manufacturer's instructions. Briefly, equal amounts of protein were run on SDS polyacrylamide gels and transferred to nitrocellulose membrane. The resulting blots were blocked with 5% non-fat dry milk and probed with antibodies. The following antibodies were used: GAPDH (KangChen Bio-tech, Shanghai, China), E-cadherin, N-cadherin (BD Transduction Laboratories, Franklin Lakes, NJ, USA), Wnt5a (R&D systems, Minneapolis, MN, USA), Arf6, Vimentin (Abcam, New Terriories, HK, China), ERK, P-ERK, Histone H3, HA and GFP antibodies (Cell Signaling Technology, Danvers, MA, USA). Protein bands were detected by incubating with HRP-conjugated antibodies (Santa Cruz, CA, USA) and visualized with ECL reagent (Millipore, Billerica, MA, USA).
+ Open protocol
+ Expand

Corresponding organizations : Nanjing Medical University, Nanjing University, Jiangsu University

5

Quantitative Analysis of lncRNA Expression

Total RNA was isolated from podocytes using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and the quantity and purity of the RNA were determined by optical density measurements at an A260/A280 ratio of ≥1.8 using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Next, cDNA was synthesized using HiScript Q RT SuperMix for qPCR (Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacturer's protocol. The SYBR Green-based qPCR reaction system consisted of a final volume of 20 µl, containing 2 µl cDNA, 10 µl SYBR-Green Mix (Takara Bio, Inc., Otsu, Japan), 4 µl primer mix and 4 µl ddH2O. The qPCR reaction was performed at 95°C for 5 min, followed by 30 cycles of 95°C for 30 sec and 50°C for 30 sec. Primers targeting lncRNAs were designed and synthetized by Thermo Fisher Scientific, Inc., and the sequences of the primers used are listed in Table I. The lncRNA expression levels were quantified using the 2−ΔΔCq method (29 (link)), with GAPDH serving as the endogenous reference gene.
+ Open protocol
+ Expand

Corresponding organizations : Guangdong Medical College, Shenzhen Children's Hospital

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!

🧪 Need help with an experiment or choosing lab equipment?
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
1. Protocol search & design
(papers, patents, application notes)
2. Protocol validation
(from literature and MDAR)
3. Lab Product search
4. Product validation from literature
5. Troubleshoot product/ protocol
6. Instant figure generation New
Want to copy this response? Create your account to unlock copy/paste and export options.