Hiscript q rt supermix for qpcr
HiScript Q RT SuperMix for qPCR is a one-step reverse transcription and real-time PCR reagent. It contains a high-performance reverse transcriptase and a hot-start Taq DNA polymerase for efficient cDNA synthesis and real-time PCR amplification.
Market Availability & Pricing
The HiScript Q RT SuperMix for qPCR (+gDNA wiper) is an officially listed product from Vazyme, available through authorized distributors. Prices for this product typically range from ¥1,150 to ¥1,350.
Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.
Is this product still available?
Get pricing insights and sourcing optionsLab products found in correlation
217 protocols using «hiscript q rt supermix for qpcr»
Quantifying Gene Expression via qRT-PCR
Quantitative RT-PCR Analysis of RNA
RNA Extraction and qRT-PCR Analysis
Quantitative Analysis of pcmfs Gene Expression
Total RNA Extraction and RT-PCR Analysis
Top 5 most cited protocols using «hiscript q rt supermix for qpcr»
Quantification of Antiviral Responses in Avian Cells
SiRNA for silencing as well as primers for plasmid construction and real-time PCR used in this study
| Purpose | Name | Sequence(5’ to3’) | Accession no. | References |
|---|---|---|---|---|
| Cloning of chMDA5 | chMDA5-F1 | AAA | GU570144.1 | |
| chMDA5-R1 | AATGGATCCCTTCTTTTGTCATC | |||
| Cloning of chMDA5 | chMDA5-F2 | |||
| chMDA5-R2 | CTAG | |||
| Cloning of chTLR3 | chTLR3-F | ATAAGAAT | NM_001011691 | |
| chTLR3-R | AAA | |||
| Cloning of dgRIG- I | dgRIG-I-F | G | JF804977.1 | |
| dgRIG-I-R | GA | |||
| Silencing | SiMDA5 | GAACGUGAAGAUGUAAAUATT | [22 (link)] | |
| Silencing | SiTLR3 | GCAGAUUGUAGUCACCUAATT | [22 (link)] | |
| Silencing | SiMAVS | UACAGGAGGCUUCAAGGAGGUGUCA | [22 (link)] | |
| Silencing | siRNA control | AUUACGGGCCAGUAAUCUAT | ||
| Real-time PCR | chIFN-β F | CAGCTCTCACCACCACCTTCTC | [24 (link)] | |
| chIFN-β R | GGAGGTGGAGCCGTATTCTG | |||
| Real-time PCR | chβ-actin F | CAACACAGTGCTGTCTGGTGGTA | [27 (link)] | |
| chβ-actin R | ATCGTACTCCTGCTTGCTGATCC | |||
| Real-time PCR | chIFN-λ F | TGAGCTGGACCTCACCATCA | NM_001128496.1 | |
| Real-time PCR | chIFN-λ R | GGGCTGTTGGCACGTCTCT | ||
| Real-time PCR | chMda5 F | TGGAGCTGGGCATCTTTCAG | [23 (link)] | |
| chMda5 R | GTTCCCACGACTCTCAATAACAGT | |||
| Real-time PCR | chMx F | TTGTCTGGTGTTGCTCTTCCT | [25 (link)] | |
| chMx R | GCTGTATTTCTGTGTTGCGGTA | |||
| Real-time PCR | IBV-GL533 | GCCATGTTGTCACTGTCTATTG | [26 (link)] | |
| IBV-GU391 | GCTTTTGAGCCTAGCGTT | |||
| IBV-Probe | FAM-CACCACCAGAACCTGTCACCTC-BHQ |
The underlined nucleotides are restriction enzyme sequences. Restriction enzymes are indicated in parentheses
Corresponding organizations : Yangzhou University
Quantification of TGEV Entry and Binding
Corresponding organizations : Nanjing Agricultural University
Differential Expression of API in H. contortus
Corresponding organizations : Nanjing Agricultural University
Gene Expression and Protein Analysis
Sample protein extraction and concentration determination of whole cells were performed as previously described [47 (link)]. Cytoplasmic and nuclear proteins were obtained using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime) according to the manufacturer's instructions. Briefly, equal amounts of protein were run on SDS polyacrylamide gels and transferred to nitrocellulose membrane. The resulting blots were blocked with 5% non-fat dry milk and probed with antibodies. The following antibodies were used: GAPDH (KangChen Bio-tech, Shanghai, China), E-cadherin, N-cadherin (BD Transduction Laboratories, Franklin Lakes, NJ, USA), Wnt5a (R&D systems, Minneapolis, MN, USA), Arf6, Vimentin (Abcam, New Terriories, HK, China), ERK, P-ERK, Histone H3, HA and GFP antibodies (Cell Signaling Technology, Danvers, MA, USA). Protein bands were detected by incubating with HRP-conjugated antibodies (Santa Cruz, CA, USA) and visualized with ECL reagent (Millipore, Billerica, MA, USA).
Corresponding organizations : Nanjing Medical University, Nanjing University, Jiangsu University
Quantitative Analysis of lncRNA Expression
Corresponding organizations : Guangdong Medical College, Shenzhen Children's Hospital
Spelling variants (same manufacturer)
Similar products (other manufacturers)
The spelling variants listed above correspond to different ways the product may be referred to in scientific literature.
These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!