Dmem f12

Four engineered cell lines were used for SyncroPatch experiments: hNa_v1.7‐HEK293 cell, hNa_v1.1‐HEK293 cells, hNa_v1.2‐CHO cells (Catalog Number CT4010; ChanTest, Cleveland, OH, USA) and hNa_v1.5‐HEK293 cells (Catalog Number CT6207; ChanTest, Cleveland, OH, USA).
HNa_v1.7‐HEK293growth medium consisted of EMEM, 10% FBS and 300 µg mL⁻¹ G418. All medium components came from Wisent (St. Bruno, QC, Canada). HNa_v1.1‐HEK293 cells growth medium consisted of DMEM /High Glucose (Cytiva, Marlborough, Massachusetts, USA), 10% FBS, 1 mg mL⁻¹ G418, 1x Penicillin Streptomycin, 3 µg mL⁻¹ Puromycin (Sigma–Aldrich, St. Louis, Missouri, USA). FBS, G418 and Pen/Strep purchased from Wisent (St. Bruno, QC, Canada). HNa_v1.5‐HEK293 cells (Catalog Number CT6207; ChanTest, Cleveland, OH, USA) growth media consisted of DMEM/F12, 10% FBS, 0.5 mg mL⁻¹ G418 and 1x Pen/Strep (Wisent, St. Bruno, QC, Canada). HNa_v1.2‐CHO EZ cells (Catalog Number CT4010; ChanTest, Cleveland, OH, USA) growth media consisted of DMEM/F12, 10% FBS (Wisent, St. Bruno, QC, Canada).
HNa_v1.7‐HEK293 cells, hNa_v1.1‐HEK293 cells and hNa_v1.5‐HEK293 cells, were cultured in T‐75 flasks at 37 °C, 5% CO₂ and split when confluency reached 70–80% to retain surface channel expression. Cells were harvested for use when confluency reached ≈70%. To harvest cells, the media was aspirated and cells were washed 2x by the addition and aspiration of 5 mL of DPBS (Dulbecco's Phosphate Buffered Saline, no Ca²⁺, no Mg²⁺; Gibco, Thermo Fisher, Waltham, Massachusetts, USA). Post washing, 2.5 mL of Accutase (Sigma–Aldrich Corporation, Saint Louis, USA) was added to flasks which were then rocked to ensure complete coverage.  Flasks were incubated at 37 °C in a 5% CO₂ incubator for 15 min. Flasks were gently rocked to dislodge the cells and 8 mL of serum free EMEM added to flasks to dilute the Accutase and inhibit cell digestion. Cells were gently triturated with a 5 mL pipette and then transferred to a 15 mL centrifuge tube. Cells were centrifuged at 1000 rpm for 4 min, and re‐suspended in chilled (4 °C) External Solution (Nanion Technologies, Munich, Germany) at a concentration of 1–5 × 10⁶ cells mL⁻¹.
HNa_v1.2‐CHO EZ cells were thawed and plated into 100 mm tissue culture dishes. Cells were incubated at 37 °C in a 5% CO₂ incubator for 2 h prior to harvesting. Harvesting was the same as described above.
The patch‐clamp whole‐cell experiments using a SyncroPatch 384PE (Nanion Technologies, Munich, Germany) were performed with the following solutions: i) internal solution for cell recording contained (in mm) CsF, 110; NaCl, 10; CsCl, 10; EGTA,10; Hepes,10 (285 mOsm; pH adjusted to 7.2 with 1 N CsOH); ii) external solution contained (in mm) NaCl, 140; KCl, 4; CaCl₂, 2; MgCl₂, 1; glucose, 5; HEPES, 10 (298 mOsm; pH adjusted to 7.4 with 1 N NaOH). All solutions were purchased from Nanion Technologies, Munich, Germany.

MCF10a cells were maintained in 1:1 DMEM/F12 (Wisent), 20 ng/mL hEGF (Gibco), 0.5 μg/mL Hydrocortisone (Sigma-Aldrich), 10 μg/mL human recombinant insulin (Sigma-Aldrich), 5% Horse Serum (Gibco), and 1% Penicillin-Streptomycin (Wisent). MCF10a cells were plated onto 6 well plates at 3 × 10⁵ cells per well. Growth media was changed 24 hours after plating with media containing 4 ng/mL hTGFb-1 (Biolegend) or normal media, and 1C8 (10 μM final concentration), GPS167 (1 μM final concentration), or DMSO. Media was replenished 48 hours after treatment start. RNA was harvested at the time of treatment (D0) and 4 days later (D4) using Qiazol reagent (Qiagen) according to the manufacturer’s instructions. cDNA was generated using Superscript IV (Invitrogen) and qPCR was performed using PowerUp Sybr Green (Applied Biosystems). All expression values were normalized to the geometric mean of hTBP and hHPRT1 expression, and statistical tests performed with Tukey’s post-hoc test from triplicate experiments.
RT-qPCR primers used for EMT assay:
hsCDH2_F AGGCTTCTGGTGAAATCGCA
hsCDH2_R TGCAGTTGCTAAACTTCACATTG
hsCDH1_F CACCACGTACAAGGGTCAGG
hsCDH1_R GGTGTATACAGCCTCCCACG
hsVIM_F CGGGAGAAATTGCAGGAGGA
hsVIM_R AAGGTCAAGACGTGCCAGAG
hsTBP_F TGCACAGGAGCCAAGAGTGAA
hsTBP_R CACATCACAGCTCCCCACCA
hsHPRT1_F GAAAAGGACCCCACGAAGTGT
hsHPRT1_R AGTCAAGGGCATATCCTACAACA.
The CellTox Green cytotoxicity assay kit (Promega) was used according to instructions provided by the manufacturer. This assay is based on fluorescence signal enhancement upon binding of Green dye to DNA from compromised cells with impaired membrane integrity. Cells were monitored for cytotoxicity over 72 h after treatment on a fluorescence plate reader. DHX33 siRNA (CAAUGAAAGUCCCAAAUGUTT) oligos were transfected into HCT116 cells at a concentration of 80 nM using Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, cells were treated with GPS167 and the CellTox Green cytotoxicity assay carried out.