Twelve SNPs (rs6713088, rs12621038, rs1682111, rs843752, rs10439478, rs843645, rs11125529, rs12615793, rs843711, rs11896604, rs17045754, and rs843720) in ACYP2 screened in previous research (Chen et al., 2016 ; Chen et al., 2017 ; Fang et al., 2016 ; He et al., 2016 ; Li et al., 2017 ; Liang et al., 2016 ; Liu et al., 2016 ; Zhang et al., 2016 ) at a minor allele frequency (MAF) > 5% in the global population were examined in our study. The amplification and extension SNP primers were designed using the Agena Bioscience Assay Design Suite V2.0 software (https://agenacx.com/online-tools/ ). The sequences of primers corresponding to each SNP are shown in Table 1 . These polymorphisms were genotyped using the Agena MassARRAY platform with iPLEX gold chemistry (Agena Bioscience) according to the standard protocol recommended by the manufacturer. Agena Bioscience TYPER version 4.0 software was used for data management and analysis.
Assay design suite v2
Manufactured by Agena
Sourced in United States
Assay Design Suite v2.0 is a software tool that assists in the design and optimization of assays used in life science research and diagnostics. The core function of this product is to provide a suite of algorithms and analysis tools to support the development of reliable and efficient assays.
Automatically generated - may contain errors
Lab products found in correlation
Typer 4, by Agena (6 mentions)
Massarray platform, by Agena (5 mentions)
Iplex gold genotyping kit, by Agena (5 mentions)
Iplex gold chemistry, by Agena (4 mentions)
Massarray iplex platform, by Agena (4 mentions)
Massarray rt software, by Agena (4 mentions)
Typer version 4, by Agena (3 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (3 mentions)
Massarray mass spectrophotometer, by Agena (2 mentions)
Omega d3494 01 blood dna midi kit, by Omega Bio-Tek (2 mentions)
Massarray system, by Agena (2 mentions)
Typer software, by Agena (1 mentions)
Typer software version 4.0, by Agena (1 mentions)
Massarray nanodispenser, by Agena (1 mentions)
Nanodrop 2000 platform, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (1 mentions)
Massarray typer v4, by Agena (1 mentions)
Massarray rs1000, by Agena (1 mentions)
Bioscience massarray system, by Agena (1 mentions)
28 protocols using assay design suite v2
1
Genotyping of ACYP2 SNPs
2
Genetic Variants and Rheumatoid Arthritis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five whole blood samples were available from each participants. According to the manufacturer’s instructions, genomic DNA was extracted from whole blood samples using the GoldMag-Mini Whole Blood Genomic DNA Purification Kit (GoldMag. Co. Ltd., Xi’an, China). The DNA concentration and purity were assessed using spectrophotometer (NanoDrop 2000; Thermo Fisher Scientific, Waltham, MA, USA). In this study, FCRL1 rs2050568, FCRL3rs2317230, and FCRL6 rs58240276 were chose to investigate the influence on the risk of RA from the 1000 Genomes Project (http://www.1000genomes.org/ ) with the minor allele frequency (MAF) > 5% [18 (link)]. The amplification and extension primers were performed through the Agena Bioscience Assay Design Suite V2.0 software (https://agenacx.com/online-tools/ ), following the guideline. Subsequently, SNPs genotyping and data analysis were conducted using the Agena MassARRAY platform (Agena Bioscience, San Diego, CA, USA) and Agena Bioscience TYPER version 4.0, respectively.
3
Genotyping of MIR17HG SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We selected four SNPs (rs75267932, rs72640334, rs7318578 and rs17735387) in MIR17HG with a minor allele frequency (MAF) >5% in the global population from the HapMap database. The primers for polymerase chain reaction (PCR) amplification and single base extension of the three SNPs were designed by the Agena Bioscience Assay Design Suite V2.0 software (https://agenacx.com/online-tools/ ). The four SNPs genotyping were performed using the Agena MassARRAY platform with iPLEX gold chemistry (Agena Bioscience, San Diego, CA, U.S.A.) according to the manufacturer’s instructions. Data were managed and analyzed using the version 4.0 Agena Bioscience TYPER software.
4
Genotyping of EYS Gene SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five SNPs from EYS were chosen for analysis in this study and they were selected from the GWAS, NCBI dbSNP (http://www.ncbi.nlm.nih.gov/snp ) and the 1000 Genomes Project databases (http://www.internationalgenome.org/ ). All five SNPs had minor allele frequencies >5% in Han Chinese Beijing population. We used the Agena Bioscience Assay Design Suite V2.0 software (https://agenacx.com/online-tools/ ) to design the primers of PCR amplification and extension of the five selected SNPs. These SNPs in EYS were genotyped in the case and control groups using the Agena MassARRAY platform with iPLEX gold chemistry (Agena Bioscience, San Diego, CA) according to the manufacturer's instructions. We used the Agena Bioscience TYPER software (version 4.0) to manage and analyze data.
5
Genotyping TERT Gene Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the public HapMap databases, we randomly selected five SNPs on the basis of their allele frequencies, location, and disease relevance etc. All SNPs in TERT (GenBank: NG_009265.1) which have been validated with minor allele frequency (MAF)> 5% in the 1,000 genome (http://www.internationalgenome.org/ ). A total of five SNPs in the TERT gene were selected for further genotyping.
We collected the subjects about 5 ml of venous blood in EDTA tubes and stored in a −80℃ refrigerator. Extraction of genomic DNA from peripheral blood using the E.Z.N.A. ® Blood Mini Kit II (Omega Bio‐tek, Inc, USA), and then concentration was detected by the NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA). Genotyping of all SNPs was performed using MassARRAY Nanodispenser (Agena Bioscience, San Diego, CA, USA and MassARRAY iPLEX platform (Agena Bioscience, San Diego, CA, USA), the experimental procedure was performed according to the manufacturer's protocol (Gabriel, Ziaugra, & Tabbaa,2009 ). Primers and multiplex reactions were designed using the Agena Bioscience Assay Design Suite V2.0 software (https://agenacx.com/online-tools/ ), the corresponding primer for each SNPs is shown in Table 1 . Data management and analysis were performed using Sequenom Typer 4.0 software (Gabriel et al., 2009 ; Thomas et al., 2007 ).
We collected the subjects about 5 ml of venous blood in EDTA tubes and stored in a −80℃ refrigerator. Extraction of genomic DNA from peripheral blood using the E.Z.N.A. ® Blood Mini Kit II (Omega Bio‐tek, Inc, USA), and then concentration was detected by the NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA). Genotyping of all SNPs was performed using MassARRAY Nanodispenser (Agena Bioscience, San Diego, CA, USA and MassARRAY iPLEX platform (Agena Bioscience, San Diego, CA, USA), the experimental procedure was performed according to the manufacturer's protocol (Gabriel, Ziaugra, & Tabbaa,
6
Genotyping of CASC15 SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood samples (5 ml) were obtained from each individual. DNA was isolated from the blood samples by GoldMag DNA purification kit (GoldMag) following the manufacturer's instructions. Subsequently, NanoDrop 2000 platform (Thermo Fisher Scientific) was performed to evaluate DNA purity and concentration. Based on the minor allele frequency (MAF) > 5% and Hardy–Weinberg equilibrium (HWE) > 0.001%, CASC15 SNPs were selected in the global population from the 1,000 Genomes Project data (http://www.internationalgenome.org/ ). When r2 (the measure value of LD) > 0.8, the SNP can represent all the polymorphisms in a block. Ultimately, six SNPs including rs1555529 (NC_000006.11:g.21691704A>G), rs7740084 (NC_000006.11:g.21727531G>A), rs1928168 (NC_000006.11:g.22017738T>C), rs12212674 (NC_000006.12:g.22086845T>A), rs4712653 (NC_000006.11:g.22125964T>C), and rs9393266 (NC_000006.11:g.22220860C>T) were finally selected in the present study. Furthermore, the Agena Bioscience Assay Design Suite V2.0 software and the MassARRAY iPLEX platform (Agena Bioscience) designed the amplification and extension primers and conducted the SNPs' genotyping. In the end, all data were performed by Agena Bioscience TYPER version 4.0 software.
7
Genetic Profiling of SLC11A1 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GoldMag DNA Purification Kit (GoldMag, China) was used to isolate the genomic DNA from samples, according to the manufacturer’s instructions. DNA purity and concentration were detected using the NanoDrop 2000 spectrophotometer (Thermo Fisher, United States). We selected the SLC11A1 gene as a candidate gene for the study, according to previously published studies (Meilang et al., 2012 (link); Harishankar et al., 2018 (link); Shahzad et al., 2022 (link)) and randomly selected five unreported SNPs (rs11695562, rs7608307, rs4674301, rs2695343, and rs13062) in or near SLC11A1 with the global minor allele frequency (MAF) greater than 0.05 from the 1000 Genomes Project data (http://www.internationalgenome.org/ ). The amplification and extension primers of each SNP were designed by Agena Bioscience Assay Design Suite V2.0 software. Moreover, the SNP genotype and data management were performed by the MassARRAY iPLEX platform and Agena Bioscience TYPER 4.0 software, respectively.
8
Genotyping of CYP1A1 and CYP1A2 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Totally, 4 variants (rs1048943, rs4646422, rs762551 and rs2470890) were selected in the global population on the basis of the 1000 Genomes Project (https://www.internationalgenome.org/ ) [17 (link)]. The minor allele frequency of every SNP was greater than 5%. Primers design for amplification and extension of SNPs listed in Supplementary Table 1 were completed by the Agena Bioscience Assay Design Suite V2.0 software (https://agenacx.com/online-tools/ ). Genomic DNA was extracted from the participants’ blood samples using the GoldMag-Mini Whole Blood Genomic DNA Purification Kit (GoldMag. Co. Ltd., Xi’an, China) regarded as the amplification template. Target amplification of SNPs was performed according to a predetermined PCR procedure, and PCR product purification was completed by agarose gel electrophoresis. After that, SNP genotyping was performed by the Agena MassARRAY platform with iPLEX gold chemistry (Agena Bioscience, San Diego, CA, USA), and data management was completed by Agena Bioscience TYPER, Version 4.0 [18 (link)].
![]()
Linkage disequilibrium (LD) analysis of five SNPs in CYP1A1, and CYP1A2. The LD value is determined by r2 > 0.8 analyzed by Haploview software, version 4.2
9
Genetic Profiling of CYP24A1 SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four SNPs (rs2762934, rs1570669, rs6068816, and rs2296241) in CYP24A1 gene were selected from the databases of the 1,000 Genomes Project with a minor allele frequency ≥0.05 in our present study. The genomic DNA of peripheral blood samples in all subjects was extracted with a blood genomic DNA purification kit (GoldMag) following the manufacturer's protocol. The purity and concentration of genomic DNA were detected by NanoDrop 2000C spectrophotometer (Thermo Scientific; Gabriel et al., 2009 ) and then kept at −20°C before further analysis. Primers for PCR amplification were designed using the Agena Bioscience Assay Design Suite V2.0 software (https://agenacx.com/online-tools/ ). SNP genotyping was identified by Agena MassARRAY iPLEX platform, and the data management and analysis were carried out using Agena Bioscience TYPER version 4.0 software.
10
Genotyping of TS Gene Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detailed data for TS SNPs (rs699517, rs2790, and rs151264360) were acquired from the dbSNP database (http://www.ncbi.nlm.nih.gov/SNP/ ). The minor allele frequency of these SNPs was 5% greater than in Chinese Han population (Dong et al. 2021 (link)). The blood genomic DNA purification kit (GoldMag) was used to extract the genomic DNA of peripheral blood samples in all subjects according to the manufacturer’s protocol. Detected by NanoDrop 2000C spectrophotometer (Thermo Scientific), the purity and concentration of genomic DNA were kept at − 20 °C before further analysis. The Agena Bioscience Assay Design Suite V2.0 software was adopted to design primers for PCR amplification. Primer information was listed in Table 1 . Sanger sequencing was adopted to identify SNPs genotyping.
Primer information for genotyping assay of the TS gene
| SNP | Primer sequences (5′-3′) | Product size (bp) |
|---|---|---|
| rs699517 | ||
| Forward | ATAATGGCCTTATTTTGTTTTTAGCTTCA | 267 |
| Reverse | TTTTGACCTAGTTCCTTTTTCTTTTAGAGC | |
| rs2790 | ||
| Forward | CCAACTATTAAAATGGAAATGGCTGTTTAG | 182 |
| Reverse | AGTGGCAACATCCTTAAAAATTAATAACTG | |
| rs151264360 | ||
| Forward | AAGTAGCATCCAAACCAGAATACA | 212 |
| Reverse | GAGCTGAGTAACACCATCGATCA |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!