The cells were lysed using an RNA isolator (R401-01; Vazyme), and total mRNA was extracted following the manufacturer’s instructions. HiScript Q RT SuperMix for qPCR (R123-01; Vazyme) was used to reverse transcribe the mRNA according to the manufacturer’s instructions. Detection was performed on an ABI 7300 QuantStudio3 PCR system using the ChamQ SYBR qPCR Master Mix (Q341-02; Vazyme). The sequences are listed in Table S4 .
Rna isolator
Manufactured by Vazyme
40 citations
Sourced in China
About the product
The RNA Isolator is a lab equipment designed for the extraction and purification of RNA from various biological samples. It utilizes a specialized protocol to efficiently isolate high-quality RNA for downstream applications, such as reverse transcription and gene expression analysis.
Automatically generated - may contain errors
Market Availability & Pricing
Is this product still available?
Get pricing insights and sourcing optionsLab products found in correlation
Hiscript 2 1st strand cdna synthesis kit, by Vazyme (5 mentions)
Sybr green master mix, by Vazyme (4 mentions)
Hieff qpcr sybr green master mix, by Yeasen (4 mentions)
Chamq sybr qpcr master mix, by Vazyme (3 mentions)
Hiscript q rt supermix for qpcr, by Vazyme (3 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (3 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Hiscript 2 first strand cdna synthesis kit, by Vazyme (2 mentions)
Lightcycler 480 2, by Roche (2 mentions)
Chamq sybr color qpcr master mix, by Vazyme (2 mentions)
Nano 100 micro spectrophotometer, by Allsheng (2 mentions)
Aceq qpcr sybr green master mix kit, by Vazyme (2 mentions)
Cfx system, by Bio-Rad (2 mentions)
Faststart essential dna green master, by Roche (2 mentions)
Iq5 multicolor real time pcr detection system, by Bio-Rad (2 mentions)
Qpcr sybr green master mix kit, by Vazyme (1 mentions)
Aceq universal sybr qpcr master mix, by Vazyme (1 mentions)
Hiscript 2 q rt supermix for qpcr reverse transcription kit, by Vazyme (1 mentions)
Abi 7500, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Check compatibility
40 protocols using «rna isolator»
1
RNA Extraction and qRT-PCR Analysis
2
Quantifying Soybean Root Gene Expression
Total RNA was isolated from soybean roots using an RNA isolator (R401–01, Vazyme Biotech, Nanjing, China), following the manufacturer’s instructions. First-strand cDNA was synthesized using HiScript II Q RT Supermix (R223–01, Vazyme) from 1 μg total RNA. We conducted qRT-PCR using Hieff qPCR SYBR Green Master Mix (11201ES, Yeasen Biotechnology, Shanghai, China) under the following thermal conditions: 5 min at 95 °C, followed by 40 cycles including 10 s at 95 °C, 20 s at 60 °C, and 20 s at 72 °C. GmELF was used as a reference gene. At least three biological repeats were conducted for each treatment. Relative gene expression levels were analyzed as described previously (Deng et al, 2022 (link)). The primers used for qRT-PCR are listed in Appendix Table S1 .
3
Quantifying Gene Expression in Cells and Bone
Total RNA from cultured cells and bone was isolated with an RNA isolator (Vazyme, Nanjing, China). cDNAs were synthesized using a reverse transcription kit (Takara, Kusatsu, Japan), and RT‐qPCR was performed in a ViiA 7 real‐time polymerase chain reaction (PCR) standard deviation system (Applied Biosystems) using SYBR GREEN (Yeason Biotech). GAPDH was used as an internal control for cDNA. The primers used in this study are described in Table S1, Supporting Information.
4
Quantitative PCR Analysis of Gene Expression
RNA was extracted from treated cells or tissues using RNA isolator (Vazyme, China) following manufacturer’s instructions. One microgram of total RNA from each sample was converted to cDNA with HiScript® II 1st Strand cDNA Synthesis Kit (Vazyme, China). For the qPCR reactions, SYBR green master mix (Vazyme, China) was used. The primers were designed in PrimerBank67 (link). GAPDH was used as an internal control. Human OLFM4 (Primer F: ACTGTCCGAATTGACATCATGG, Primer R: TTCTGAGCTTCCACCAAAACTC), human GAPDH (Primer F: GGAGCGAGATCCCTCCAAAAT, Primer R: GGCTGTTGTCATACTTCTCATGG), human CTGF (Primer F: ACCGACTGGAAGACACGTTTG, Primer R: CCAGGTCAGCTTCGCAAGG), human CYR61 (Primer F: CTCGCCTTAGTCGTCACCC, Primer R: CGCCGAAGTTGCATTCCAG).
5
Quantitative RT-PCR for Gene Expression
The entire RNA content was extracted from both tumor tissues and cell lines, utilizing an RNA isolator (Vazyme, Nanjing, China). All-in-one 1st Strand cDNA Synthesis SuperMix Kit (Novoprotein, Jiangsu, China) was utilized to generate complementary DNA (cDNA) from RNA. The RT-qPCR was performed using Hieff® qPCR SYBR Green Master Mix (Yeasen, Shanghai, China) on the QuantStudio5 Real-Time PCR System (Applied Biosystems, USA). The relative expression levels of the target genes were normalized to endogenous ACTB. The target transcripts’ primer sequences are provided in Supplementary Table S1 .
Corresponding organizations : Xiangya Hospital Central South University, Central South University
Top 5 most cited protocols using «rna isolator»
1
Liver RNA Extraction and qPCR Analysis
Total RNA was extracted from liver tissues using an RNA isolator (Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China) in accordance with the manufacturer’s instructions. Reverse transcription was performed using a HiScript® II 1st Strand cDNA Synthesis kit (Vazyme Biotech Co., Ltd., Nanjing, China). Real-time PCR was performed using a Bio-Rad CFX System and AceQ qPCR SYBR Green Master Mix kit (Vazyme Biotech Co., Ltd., Nanjing, China) following the method described previously [28 (link),29 (link)]. The primer sequences listed in Table 1 are designed for mice genes.
Corresponding organizations : Anhui Agricultural University
2
Real-Time PCR Analysis of Candidate Genes
Total RNA was extracted from culture cells using RNA isolator (Vazyme, China). 1 μg of total RNA was reverse transcribed into complementary DNA (cDNA) using HiScript III RT SuperMix for qPCR with gDNA wiper (Vazyme, China). Then, real-time PCR was performed using ChamQ™ Universal SYBR qPCR Master Mix (Vazyme, China). The cycler protocol was 5 min at 95°C, 40 cycles of 15 s at 95°C, 60 s at 60°C, and 5 min at 72°C [18 (link)]. All primers were synthesized by Tsingke (Beijing, China) and listed in Table 1 . The mRNA expression levels of the 10 candidate genes were calculated using the 2−ΔΔCt method and normalized against that of GAPDH.
Corresponding organizations : Ruijin Hospital, Shanghai Jiao Tong University
3
Quantitative RT-PCR for Gene Expression
Total RNA extraction reagent RNA isolator (Vazyme) was used to RNA extraction from cells. RNA samples were then transcribed into cDNA using a cDNA Synthesis Kit (Vazyme). Levels of mRNA were analysed with iQ5 Multicolor Real‐Time PCR Detection System (Bio‐Rad) with FASTSTART ESSENTIAL DNA GREEN MASTER (Roche). The mRNA levels were normalized to the expression of 18S rRNA. The primer sequences are as following:
| Genes | Forward primer (5′‐3′) | Reverse primer (5′‐3′) |
|---|---|---|
| 18S rRNA | AGTCCCTGCCCTTTGTACACA | CGTTCCGAGGGCCTCACT |
| Tgfa | TGATGCACTGAAGGTTAATATG | AACAAGGTACAATACAACTGAG |
| Cdc7 | GGGTCTTAGGTAGTTGAGAAA | CCACATTCACAGCAGTAAC |
| Prkca | GGAAGGAGTGAAGGTTGA | GCATCTAACAGAGCGAATC |
| Hif1a | TGCCTAGTATGTTAATTTGTTGA | CAAAGAGCAAGGGAATGAAA |
| Myocd | ACTGGGAGAGCAAAGAAG | GAGAACAGGAAGCAATACAC |
| Vegfa | CGGTACTTATTTAATAGCCCTTT | GAGAGATTGGAAACACAGATTT |
| Gpnmb | GGGATGGGAAGACAGTATT | CGCTCAGGTATGTTCAATG |
| Mmp2 | TTGCTTTGTTTGCCCTTT | TGACTGGAGTTGCTTCTAC |
| Rufy3 | GAGCATCCACGAGAATCT | CTTCCACAAGGTCACACT |
Corresponding organizations : Nantong University, Affiliated Hospital of Nantong University
4
Quantifying Melanogenic Gene Expression
Total RNA was extracted using an RNA isolator (Vazyme, China) and determined with the manufacturer’s protocol. Reverse transcription of RNA into cDNA was performed using the Superscript First-Strand Synthesis System (Thermo Fisher, United States). Real-time polymerase chain reaction (PCR) was carried out on a system (7500 Fast) using SYBR Green PCR Master Mix (Roche Molecular Biochemicals, Germany). Primers sequences, TYR: forward: CACCTGAGGGACCACTATTACG, reverse: GGCAGTTCTATCCATTGATCCAG; TRP-1: forward: ATCATCGGCCAAAACGATCAT, reverse: GCAGCTAAAATAACAGGTGCGA; DCT: forward: TTCTGCTGGGTTGTCTGGG, reverse: CACAGATGTTGGTTGCCTCG; MITF: forward: CAAATGGCAAATACGTTACCCG, reverse: CAATGCTCTTGCTTCAGACTCT; β-Actin: forward: GGGAAATCGTGCGTGAC, reverse: AGGCTGGAAAAGAGCCT.
Corresponding organizations : Shanghai University of Traditional Chinese Medicine, Shuguang Hospital
5
Quantitative RT-PCR for Gene Expression
RNA isolator (Vazyme, Nanjing, China) was used following the manufacturer’s protocol to extract the total RNA from bEnd.3 cells. The purity and concentration of isolated RNA were determined with a NANO-100 microspectrophotometer (ALLSHENG, Hangzhou, China), and an equal amount of RNA was reverse-transcribed into cDNA using an HiScript® Q RT SuperMix for qPCR (Vazyme, Nanjing, China). Real-time PCR was then performed on LightCycler 480 II (Roche, Switzerland) with the primers and ChamQ SYBR Color qPCR Master Mix (Vazyme, Nanjing, China). The mRNA levels were normalized against Actb and quantified using the 2−ΔΔCt method. Primer sequences are listed in Table S1 .
Corresponding organizations : China Pharmaceutical University
Spelling variants (same manufacturer)
Similar products (other manufacturers)
Isolator (by AtriCure) - 11 citations
RNA isolator total RNA extraction reagent (by Takara Bio) - 7 citations
Isolator (by DuPont) - 5 citations
RNA isolator (by Takara Bio) - 4 citations
Isolators (by Getinge) - 4 citations
Isolator (by Park Bioservices) - 4 citations
RNATM (by CinnaGen) - 4 citations
The spelling variants listed above correspond to different ways the product may be referred to in scientific literature.
These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!
🧪 Need help with an experiment or choosing lab equipment?
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
1. Protocol search & design
(papers, patents, application notes)
(papers, patents, application notes)
2. Protocol validation
(from literature and MDAR)
(from literature and MDAR)
3. Lab Product search
4. Product validation from literature
5. Troubleshoot product/ protocol
6. Instant figure generation New
Want to copy this response? Create your account to unlock copy/paste and export options.