β mercaptoethanol

CRISPR-mediated knockout plasmids containing guide RNAs targeting BAX, BAK1, NCKAP1, ACSL4, SLC7A11, CYFIP1, WAVE-2, Abi2, HSPC300 were generated in lentiCRISPR v2 (Addgene, #52961) according to the standard protocol. The SLC7A11 cDNA–containing expression construct was described in previous publications^{25 , 26} . The lentiviral construct expressing membrane-bound green fluorescent protein (mGFP) (#22479) and Rac1-Q61L cDNA-containing construct (#84605) were obtained from Addgene. NCKAP1 cDNA and shRNA constructs targeting RPN1, N-WASP, WHAMM were obtained from the Functional Genomics Core Facility of The University of Texas MD Anderson Cancer Center. NCKAP1 and Rac1-Q61L cDNA were subsequently cloned into the vector pLX302 with a C-terminal V5 tag (Addgene, #25896). WAVE-2 constructs were provided by Dr. Daniel D. Billadeau. All constructs were confirmed by DNA sequencing. The sequences of gRNAs and shRNA used in this study are listed in Supplementary Table 4. Necroptosis inhibitor Nec-1s (#2263) was from BioVision, and necrosis inhibitor Necrox-2 (#ALX-430-166-M001) was from Enzo. Ferroptosis inducer (1S,3R)-RSL3 (#19288) and apoptosis inducer staurosporine (#81590) were from Cayman Chemical. L-[1, 2, 1', 2'-14C]-cystine (#NEC854010UC) was from PerkinElmer. KL-11743 was from Kadmon. The following reagents were obtained from Sigma-Aldrich: 2-deoxy-D-glucose (#D8375-1G), Trolox (#238813), 4-Hydroxy-TEMPO (Tempol) (#176141), beta-mercaptoethanol (2ME) (#M6250), deferoxamine mesylate salt (DFO) (#D9533), ferrostatin-1 (#SML0583), chloroquine (#C6628), diamide (#D3648), diethyl-maleate (#D97703, BAY-876 (#SML1774), and L-Cystine (#C7602). All reagents were dissolved according to manufacturers’ instructions.

All cell cultures were maintained at 37 °C, 5% CO₂. hES and iPS cells (HUES3 (control), male; H9 (control), female; HS001 (ALS-SOD1 N139K), male; LWM002 (ALS-SOD1 A4V), female; MBN007 (ALS-SOD1 A4V), female; TM008 (ALS-SOD1 A4V), female; DCM009 (ALS-SOD1 V148G), male; 10013.13 (control), male) were maintained on gelatinized tissue-culture plastic on a monolayer of irradiated CF-1 mouse embryonic fibroblasts (MEFs; GlobalStem), in hESC media, consisting of Dulbecco’s Modified Eagle Medium: nutrient mixture F-12 (DMEM/ F:12, Invitrogen) with 20% Knockout Serum Replacer (KSR; Invitrogen), 110 µM β-mercaptoethanol (BME; Sigma), L-Glutamine and non essential amino acids (NEAA; Invitrogen), and 20 ng/ml basic fibroblast growth factor (bFGF; Invitrogen) (Cowan et al., 2004 (link)). Media was changed every 24 hours and lines were passaged with dispase (Gibco, 1 mg/mL in hES media for 15–30min at 37 °C).
To generate motor neurons, undifferentiated hESCs were passaged using dispase (1 mg/mL) and triturated into small, 50- to 100-cell clumps and placed into ultra-low adherent culture dishes (Corning). For the first three days, cells were kept in suspension in hESC medium, supplemented with 10 µM Rho-associated kinase inhibitor Y27632 (Ascent Scientific) to enhance single cell survival (Watanabe et al., 2007 (link)), 20 ng/mL bFGF (Invitrogen) to enhance growth and 10 µM SB435142 (SB, Sigma) and 0.2 µM LDN193189 (LDN, Stemgent) for neuralization. At day 3, eymbroid bodies (EBs) were switched to neural induction medium (DMEM/F:12 with L-glutamine, NEAA, penicillin/streptomycin, heparin (2 µg/ml), N2 supplement (Invitrogen). At day 5, all-trans retinoic acid (RA; 0.1 or 1 µM, Sigma), ascorbic acid (0.4 µg/ml, Sigma), and BDNF (10 ng/mL, R&D) were added. Dual ALK inhibition (SB+LDN) was pursued until day 7. Hedgehog signaling was initiated on day 7 by application of either C25II modified SHH (R&D), at the standard concentration of 200 ng/ml, a human Smo agonist (HAG, 1 µM, gift from Lee Rubin (Boulting et al., 2011 (link); Dimos et al., 2008 (link))), mouse Smo agonist 1.3 (SAG, 1 µM, (Boulting et al., 2011 (link); Frank-Kamenetsky et al., 2002 (link); Wada et al., 2009 (link); Wichterle et al., 2002 (link))), or purmorphamine (PUR, 1 µM, (Li et al., 2008 (link); Sinha and Chen, 2006 (link)), Stemgent). At day 17, basal medium was changed to Neurobasal (Invitrogen), containing all previous factors and with the addition of 10 ng/mL each of IGF-1, GDNF, and CNTF (R&D), plus B27 (Invitrogen). At day 20 or 30, EBs were dissociated with 0.05% trypsin (Invitrogen), and plated onto poly-lysine/laminin-coated 8-well chamber slides (BD Biosciences) at 0.2–0.5.10⁶ cells/well, and/or 15-mm coverslips at 0.5.10⁶. Plated neurons were cultured in the same medium with the addition of 25 µM BME, and 25 µM glutamic acid (Sigma), and fixed 1 day later.
For immunocytochemistry assays, cultures were fixed for 30 minutes with 4% PFA in phosphate buffered saline (PBS) at 4 °C, washed 3 times for 5 min in PBS, quenched and permeabilized in wash buffer (PBS, 0.1% Triton X-100) plus 50 mM glycine for 15 min. For the EB outgrowth RALDH2 staining, samples were fixed for 10 minutes at room temperature with 4% PFA/10% sucrose pre-warmed to 37°C. Samples were blocked with wash buffer plus 10% normal donkey serum for 1 hr and incubated with primary antibody (Table 1) overnight. Cells were then washed, incubated with DyLight coupled donkey primary anti secondary antibodies (Jackson Immunoresearch, 1:1,000). Finally, cells were washed and counterstained with DAPI (Invitrogen).
Quantitative image analysis of differentiated neuronal cultures was performed using the Multi-Wavelength Cell Scoring module in MetaMorph^© software (Molecular Devices). Briefly, EBs were dissociated enzymatically and plated in the presence of neurotrophic factors at densities for which cell overlap was minimal. Following immunostaining, images of at least 9 randomly selected fields (>15,000 cells in total) for each condition were captured using a pre-programmed automated microscope stage. Images were analyzed using the “Multi-Wavelength Cell Scoring” module of the MetaMorph^© software, using parameters pre-defined to count only unambiguous bright labeling for each antigen. Intensity thresholds were set while blinded to sample identity, to selectively identify positive cells that displayed unambiguous signal intensity above local background. These parameters were used on all samples in a given experiment, and only minimally adjusted for different staining batches as necessary. Script and Parameter files are available upon request (typically, a cell was ~5,000 grey levels above background to be called positive for any nuclear marker, and was ~10,000 for cytoplasmic markers). A minimum of 15,000 cells per sample was analyzed. All samples were imaged using 10× or 20× objectives on a Zeiss AxioObserver with a Coolsnap HQ₂ camera (Photometrics). Some images were acquired using a structured illumination technique using an Apotome module (Zeiss) to achieve 1.9 µm optical sections to ensure co-localization of labeling. For the figures, the brightness and contrast of each channel of an image were adjusted in an appropriate manner to improve clarity.
For Ca²⁺ imaging experiments utilizing the Hb9::GFP reporter, stem cells were differentiated under the motor neuron differentiation protocol described above, dissociated at day 21 or day 31 and FACS-sorted based on GFP intensity with a 5 laser ARIA-IIu ROU Cell Sorter configured with a 100 µm ceramic nozzle and operating at 20 psi, BD BioSciences. The H9 assays were comprised of mixed neuronal cultures, which a parallel coverslip was stained and quantified to have 53% HB9/ISL1⁺ motor neurons. All cultures were plated onto 15–25 mm diameter coverslips at a density of 100,000–150,000 cells per coverslip in day 17+ neurobasal media with factors described above with the addition of 0.5 µM EdU, and matured 6 days prior to Ca²⁺ imaging. Cells were loaded with 3 μM Fluo-4 AM (Invitrogen, Carlsbad, CA) dissolved in 0.2% dimethyl sulfoxide/0.04% pluronic acid (Sigma) in HEPES-buffered physiological salt solution (PSS) for 1 hour at room temperature. PSS contained (mM): NaCl 145, KCl 5, HEPES 10, CaCl₂ 2, MgCl₂ 2 and glucose 5.5, pH 7.4. Cultures were continuously superfused with PSS at a rate of approximately 0.5 ml/minute. The cultures were imaged using a 10× objective on an inverted epi-fluorescent Zeiss AxioObserver microscope, equipped with a Coolsnap HQ₂ camera (Photometrics). For imaging spontaneous Ca²⁺ transients, single sets of 200–300 images were acquired at a rate of approximately 2 Hz from each coverslip. For the kainate experiments, 36 images were acquired at a rate of 0.033 Hz and the superfusing PSS was replaced with PSS containing kainate (100 μM) for 60 seconds. Image analysis was performed using ImageJ (http://rsb.info.nih.gov/ij/) or AxioVision 4.7 (Zeiss). Ca²⁺ transients were determined from regions of interest encompassing the soma of individual cells. A minimum of two cultures obtained from a single differentiation of each cell line and each time point were used for the kainate and all Ca²⁺ imaging experiments.
For whole cell patch clamp recordings, S+P differentiated HUES3 Hb9::GFP cells were plated on polyornithine/laminin-coated 25 mm diameter coverglass at density of 50,000 per coverslip and cultured for 7 days in the presence of 0.5 µM EdU prior to recording (i.e. DIV 21+7). Current clamp recordings were carried out using an Axopatch 2B amplifier. Data were digitized using a Digidata 1322A digital to analogue converter and were recorded at a 10 KHz sample rate using pClamp 10 software (all equipment from Molecular Devices). Patch pipettes were fabricated using a P-97 pipette puller (Sutter Instruments). The external recording solution contained (in mM), 145 NaCl, 5 KCl, 10 HEPES, 10 glucose, 2 CaCl₂, 2 MgCl₂. The pH was adjusted to 7.3 using NaOH and the osmolality adjusted to 325 mOsm with sucrose. The pipette solution contained (in mM): 130 CH₃KO₃S, 10 CH₃NaO₃S, 1 CaCl₂, 10 EGTA, 10 HEPES, 5 MgATP, 0.5 Na₂GTP, pH 7.3, 305 mOsm. Experiments were carried out at room temperature (21 – 23 °C). During recordings, current was injected to hold the cells at approximately −60 mV. Action potentials were evoked using incrementally increasing current steps 1 s in duration. The maximum amplitude of the current step (20 – 50 pA) and the size of the increment was calculated based on the input resistance of the cell.
To perform xenotransplantations day 21 EBs from HUES3 Hb9::GFP under the ventralization with SAG+PUR were collected and placed into L-15 media (Invitrogen) containing penicillin/streptomycin (GIBCO). Transplantation was performed as previously described (Wichterle et al., 2002 (link)). Briefly, after a small suction lesion at the prospective intraspinal site was created in a chick embryo at stage 15–18 at somites 15–20, lightly triturated EBs were loaded into a handheld micro-injector. The EBs was placed into the lesion. After 48 hours, the chicks were sacrificed, fixed with 4% PFA for 2 hours at 4°C, and neurite outgrowth and cell body placement was accessed by cutting 200 µm vibratome sections (n = 2), and by cutting 30 µm sections along the spinal cord (n = 5).
Human fetal spinal cords were collected in accordance with the national guidelines of the United States (NIH, FDA) and the State of New York and under Columbia University institutionally approved ethical guidelines relating to anonymous tissue. The fetal material was obtained after elective abortions, and was classified on the basis of external morphology according to the Carnegie stages. Gestational age was determined by last menstrual period of the patient or by ultrasound, if the ultrasound estimate differed by more than one week as indicated by the obstetrician. The spinal cord was removed as intact as possible prior to fixation with fresh, cold 4% PFA for 1.5 hours on ice. Post fixation, the cord was measured and cut into 3 anatomical sections to accommodate embedding in OCT Compound (Tissue-Tek, Redding, CA) and stored at −80 °C prior to cutting on a microtome. 12µm sections were cut along the full length of the cord, taking care to have all 3 sections on each slide in 7 independent sections. This allowed for full analysis and internal staining controls since each slide had cervical, brachial, thoracic and lumbar sections that clearly showed staining within the various motor columns present at different rostal-caudal levels of the spinal cord.
cDNA was obtained from 50,000 FACS purified MN’s from either day 21 S+P (methods described above), or from RA/SHH MN’s at day 31. cDNA preparation was carried out using commercially available kits following the manufacturer’s instructions: RNA isolation (Trizol LS; Invitrogen), cDNA by Brilliant II SYBR green (Stratagene) without amplification. All samples were processed in parallel on the same qPCR plate.

primers:	Forward	Reverse
RALDH2	TTTTGCTGATGCTGACTTGG	GCAGCACTGACCTTGATTGA
FOXP1	TGACCTTTTGAGGTGACTATAACTG	TGGCTGAACCGTTACTTTTTG
LHX3	GTTCAGGAGGGGCAGGAC	CCCAAGCTCCCGTAGAGG
CHT1	AAGCCATCATAGTTGGTGGCCGAG	CCAAGCTAGGCCATAACCTGGTAC
HOXA5	CAGCACCCACATCA	CGGAGAGGCAAAGA
HOXC6	CCAGGACCAGAAAGCCAGTA	GTTAGGTAGCGATTGAAGTGAAA
HOXC8	CTTCGCTGTTTGATTTCTATTCTG	TACGCTGGAGGTTTCTTTCTTT
HOXD9	TCGCTGAAGGAGGAGGAGA	CAAACACCCACAAAGGAAAAC
STD qPCR amplification: 95°- 30”, 55°-60”, 72°-45”

For paired-end RNA-Seq experiments, 400 ng of total RNA was prepared after FACS purification of 500,000 GFP⁺ or GFP⁻ cells. The RNA samples were then amplified using a NuGEN RNA kit for genomic sample amplification, and sequenced to a depth of 21 (S+P) and 35 (SHH) million paired-end reads on an Illumina HiSeq instrument at the HudsonAlpha Institute of Biotechnology. The reads were aligned to the reference transcriptome as well as a library of exon junctions using Bowtie (Version 1) (Langmead et al., 2009 (link)). Data was analyzed using Expression Plot (Friedman and Maniatis, 2011 (link)) using a P value of 0.001 and a 2 fold change threshold. Gene ontology was performed using DAVID (Huang et al., 2008 , 2009 (link)) with enrichment sets from Expression Plot. The RNA-seq data is available in the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) under the accession number GSE41795.
All quantitative data was analyzed using Sigma Plot 11 or Microsoft Excel. Sample groups were subject to Student’s t-test or where appropriate a One-Way ANOVA with Holm-Sidak post hoc pair-wise comparisons was performed. All experimental data passed an equal variance and normality test (Shapiro-Wilk).