Free access supported by contributions and sponsoring — share your knowledge or support us financially
Log In Sign up
Search / Compare / Validate Lab equipment & Methods

Liberase tl

Manufactured by Roche
Visit Supplier
Sourced in Switzerland, United States, Germany, United Kingdom, Denmark, France
About the product

Liberase TL is a digestive enzyme mixture used in laboratory applications. It is designed to dissociate tissue samples into single cells or small cell clusters. The product consists of a blend of purified enzymes that effectively break down the extracellular matrix, allowing for the isolation of viable cells from various tissues.

Automatically generated - may contain errors
Get Technical Specifications Find protocols

Lab products found in correlation

Dnase 1, by Roche (245 mentions) Dnase 1, by Merck Group (198 mentions) Dnase, by Roche (70 mentions) Dnase, by Merck Group (57 mentions) Hepes, by Thermo Fisher Scientific (39 mentions) Rpmi 1640, by Thermo Fisher Scientific (36 mentions) Liberase, by Roche (36 mentions) Percoll, by GE Healthcare (30 mentions) Ionomycin, by Merck Group (29 mentions) Gentlemacs dissociator, by Miltenyi Biotec (28 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (27 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (26 mentions) L glutamine, by Thermo Fisher Scientific (25 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (25 mentions) Bovine serum albumin (bsa), by Merck Group (25 mentions) Dnase 1, by Thermo Fisher Scientific (25 mentions) Hanks balanced salt solution (hbss), by Thermo Fisher Scientific (23 mentions) Streptomycin, by Thermo Fisher Scientific (22 mentions) Lsrfortessa, by BD (22 mentions) Ethylene diamine tetraacetic acid (edta), by Thermo Fisher Scientific (22 mentions)
Check compatibility

Market Availability & Pricing

Liberase™ TL Research Grade is an enzyme product commercialized by Roche and available through authorized distributors. The typical price range for a 10 mg package is $82.20 to $128.40.

Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.

Is this product still available?

Get pricing insights and sourcing options

Spelling variants (same manufacturer)

Liberase - 2583 citations Liberase TL purified enzyme blend - 15 citations Liberase TL enzyme - 10 citations Liberase TL enzyme blend - 5 citations Liberase TL stock solution - 3 citations Liberase™ TL enzyme preparations - 3 citations DNAse/Liberase TL - 2 citations Liberase TL and Dnase I - 2 citations Liberase TL enzyme mixture - 2 citations Collagenase/liberase TL - 2 citations

Similar products (other manufacturers)

Liberase (by Merck Group) - 610 citations Liberase TL (by Merck Group) - 264 citations Liberase (by Thermo Fisher Scientific) - 44 citations Liberase TL solution (by Merck Group) - 8 citations Liberase TL (by Thermo Fisher Scientific) - 4 citations Liberase TM (by Blendzyme) - 4 citations Liberase (by Worthington) - 3 citations Liberase (by mlRoche) - 3 citations Liberase TL TM (by Sigma-Aldritch) - 2 citations Liberase (by Promega) - 2 citations

The spelling variants listed below correspond to different ways the product may be referred to in scientific literature.
These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.

Product FAQ

1 107 protocols using «liberase tl»

1

Multiparametric Analysis of Splenic Cells

2025
Spleen was harvested in R10 medium (RPMI Medium 1640 (Gibco®). Spleen was digested for 10 min with 0.25 mg/ml Liberase TL (Roche) and 50 μg/ml DNaseI (Sigma Aldrich), after incubation time single cells solution was obtained after mechanical disintegration and filtered out 70 μm filters. For the analysis of spleen single cell cells were labelled with a viability staining Aqua dead cell stain kit (Thermofisher) 30 min. Then cells were stained with a cocktail of antibodies with CD45-BV570 (BD Pharmigen); CD11b-BV605 (Biolegend); CD11c-PECy7 (Biolegend); F4/80-BV711 (Biolegend); MHCII-UV737 (Biolegend); CD90-UV805 (Biolegend); B220-PerCP (Biolegend); Ly6G-Pacific blue (Biolegend) 1:200 for 20 min. For intracellular staining cell were fixed with PFA 4% 15 min and permeabilized with permeabilization buffer (BSA 1%, Saponin 0.1% in miliQ water) for 30min. After that time cells was washed and stained with cocktail of antibodies TΝF-PE and IL-6-APC (1:50) for 1h. Samples were analyzed on FACSymphony (Becton Dickinson) and quantification was performed using FlowJo software (TreeStar Inc).
Robles-Vera I., Jarit-Cabanillas A., Brandi P., Martínez-López M., Martínez-Cano S., Rodrigo-Tapias M., Femenía-Muiña M., Redondo-Urzainqui A., Nuñez V., González-Correa C., Moleón J., Duarte J., Conejero L., Mata-Martínez P., Díez-Rivero C.M., Bergón-Gutiérrez M., Fernández-López I., Gómez M.J., Quintas A., Dopazo A., Sánchez-Cabo F., Pariente E., del Fresno C., Subiza J.L., Iborra S, & Sancho D. (2025). Microbiota translocation following intestinal barrier disruption promotes Mincle-mediated training of myeloid progenitors in the bone marrow. Immunity, 58(2), 381-396.e9.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
2

Retinal Flow Cytometry Analysis

2025
For flow cytometry, retinas were collected in PBS (Gibco) and placed on ice immediately following CO2 narcosis and cervical dislocation. Retinas were first enzymatically dissociated by incubation with Liberase TL (final concentration 0.15 mg/ml, Roche) at 37 C for 30 min, and then dissociation was completed mechanically by gently pipetting with a P1000 pipette. The resulting cell suspensions were filtered by passing through a 70 μm filter (Miltenyi) and rinsed with PBS. Cells were labelled with a viability dye (Viobility 405/520 fixable dye, diluted 1:100, Miltenyi) following manufacturer recommendations for 15 min at room temperature. After a PBS wash, cells were then labelled for 30 min on ice with the relevant flow cytometry antibodies: VioBlue-conjugated anti-mouse CD45, APC-conjugated anti-mouse CD11b, FITC-conjugated anti-mouse MHCII, PE-conjugated anti-mouse CD31, and PE-Vio770-conjugated anti-CD115 (all antibodies diluted 1:50 in PBS for a final concentration of 3 µg/ml, all purchased from Miltenyi). Finally, cells were fixed in 1% PFA (ThermoFisher). All samples were run on a FACSCelesta Cell Analyzer (BD Biosciences, USA). The software FlowJo (BD, Oregon, USA) was used for all flow cytometry analysis.
Yang T., Ronning K.E., Augustin S., Blond F., Nous C., Argyriou F., Touhami S., Delarasse C., Guillonneau X, & Sennlaub F. (2025). Chronic intermittent hypoxia disrupts protective microgliosis in ischemic proliferative retinopathy. Journal of Neuroinflammation, 22, 82.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
3

Pancreatic Islet Isolation and Glucagon Secretion Assay

2025
Pancreatic islets were isolated from mice as previously described (82 (link)). Briefly, mice were sacrificed by cervical dislocation and pancreata perfused by intraductal injection of 2.5 mL collagenase (Liberase TL [Roche 5401020001] in serum-free RPMI 1640 [Gibco 11875–085]). Pancreata were incubated at 37°C for ~12 min with an additional 1 mL of digestion solution. Digestion was stopped by adding cold HBSS with 10% FBS. Islets were washed and hand-picked under a dissecting microscope, then allowed to recover overnight in RPMI medium in a humidified incubator (95% air, 5% CO2) at 37°C prior to further analysis. For static secretion experiments, 10 size-matched purified islets were incubated in 200 μl KRBB (Krebs-Ringer Solution, HEPES-buffered, Thermo-Fisher Scientific J67795.K2) containing D-glucose +/− L-arginine hydrochloride (MilliporeSigma A5131) and media collected at the indicated times. Following the experiments, islets were lysed (50 mM Tris HCl pH 7.4, 1 mM EDTA, protease inhibitor [MilliporeSigma P8340], phosphatase inhibitor [MilliporeSigma P5726]), total protein concentrations determined by Pierce BCA assay (Thermo Fisher Scientific), and media and lysate glucagon levels measured by ELISA as above.
Zhu W., Pan L., Cui X., Russo A.C., Ray R., Pederson B., Wei X., Lin L.L., Hafner H., Gregg B., Shrestha N., Liu C., Naji A., Arvan P., Sandoval D.A., Lindberg I., Qi L, & Reinert R.B. (2025). SEL1L-HRD1 ER-Associated Degradation Facilitates Prohormone Convertase 2 Maturation and Glucagon Production in Islet α Cells. bioRxiv.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
4

Synovial Tissue Processing for scRNA-Seq and RNA-Seq

2025
Synovial tissue processing was performed according to the protocol reported by Donlin et al. (8 (link), 11 (link), 38 (link)). Immediately after collection, surgical specimens were removed from bone and adipose tissues using surgical scissors, and the remaining synovial tissues were cut into smaller pieces before enzymatic treatment. For scRNA-Seq sample preparation, synovial tissues that had been cryopreserved by CryoStor CS10 (HemaCare Corporation) at –80°C were thawed in RPMI-1640 medium and digested in RPMI-1640 medium containing 0.2 mg/mL Liberase TL (Roche) and 0.1 mg/mL DNase I (Nakarai Tesque) for 30 min at 37°C. After enzymatic treatment, the cell suspension was centrifuged (150g for 3 minutes) and washed, and erythrocytes were lysed using RBC Lysis Buffer (10×) (BioLegend). For RNA-Seq sample preparation, synovial tissues from the suprapatellar site were crushed with a bead homogenizer, dissolved in TRI Reagent (Molecular Research Center), and stored at –80°C until sample submission. For flow cytometry, we used nonfrozen tissues, and there was no thawing process in sample preparation.
Miyahara J., Omata Y., Chijimatsu R., Okada H., Ishikura H., Higuchi J., Tachibana N., Nagata K., Tani S., Kono K., Kawaguchi K., Yamagami R., Inui H., Taketomi S., Iwanaga Y., Terashima A., Yano F., Seki M., Suzuki Y., Baron R., Tanaka S, & Saito T. (2025). CD34hi subset of synovial fibroblasts contributes to fibrotic phenotype of human knee osteoarthritis. JCI Insight, 10(2), e183690.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
5

Tumor Tissue Dissection and T Cell Profiling

2025
Tumor tissues from both human and mouse samples were dissected and placed in RPMI medium, then mechanically disrupted using scissors, digested with a mixture of DNase I (0.3 mg/mL, Sigma-Aldrich) and Liberase TL (0.2 mg/mL, Roche) in serum-free RPMI 1640 medium for 30 min. The resulting cell suspension was passed through a 70 µm cell strainer (Beyotime Biotechnology). Flow cytometric analysis was performed using a flow cytometer (Cytoflex, Beckman). All antibodies were purchased from Biolegend (USA). For cell surface staining, fluorochrome-conjugated antibodies (CD45, CD8, CD38, and PD-1) were used to identify CD45+CD8+ T cell populations.
For ex vivo restimulation, freshly isolated single cell suspensions were cultured in complete RPMI 1640 medium containing PMA (50 ng/mL) and ionomycin (500 ng/mL) for 3 h. Intracellular IFN-γ production was assessed via staining with IFN-γ mAbs (clone XMG1.2, Invitrogen). Multicolor FCM analyses were performed on the Cytoflex (Beckman), and data were analyzed using FlowJo software (Tree Star).
Lv L.L., Zhai J.W., Wu J.J., Fan G.Q., Zhang Y.X., Shen Y., Qu Q.X, & Chen C. (2025). High CD38 expression defines a mitochondrial function-adapted CD8+ T cell subset with implications for lung cancer immunotherapy. Cancer Immunology, Immunotherapy : CII, 74(2), 49.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols

Top 5 protocols citing «liberase tl»

1

Derivation and Characterization of Skin Cancer-Associated Fibroblasts

Cited 7 times
Conditions for culturing of cells, viral infection, siRNA-mediated gene silencing, RT-qPCR and Chromatin Immunoprecipitation (ChIP) were previously as reported 17 (link),58 (link),59 (link). For derivation of CAFs, surgically excised discarded skin SCCs samples were cut in 1–2mm pieces after removal of fat excess, followed by incubation in 2 ml of PBS containing 0.25 mg/ml of Liberase TL (Roche) for 40 min at 37°C with gentle shaking. After equal volume addition of FBS to stop the enzymatic digestion, the dissociated tissue was passed through a 10 ml syringe attached to a 70 µm sieve. Cells from the flow through were centrifuged, washed three times with DMEM 10% FBS and seeded in a 10 cm tissue culture dish. Adherent cells were expanded for characterization as with HDFs. Skin SCC13 60 (link) and oral Cal27 SCC cells 61 (link) were originally reported and subsequently checked for presence of oncogenic mutations 62 (link) (https://cansar.icr.ac.uk/cansar/cell-lines/CAL-27/mutations/). They have been routinely tested for mycoplasma and have not been authenticated for STR profiling. They were infected with a DsRed2 expressing lentivirus and puromycin selected. Human THP 1 monocytic leukemic cells were differentiated into adherent macrophages (MΦ) by treatment with 10 µM 12-O-tetra-decanoylphorbol-13-acetate (TPA) plus/minus activation by overnight treatment with 1 µg/ml lipopolysaccharide (LPS). Human umbilical vein endothelial cells (HUVEC) and mouse primary lung endothelial cells were kindly provided by Dr. Tatiana Petrova. Human WI-38 diploid lung fibroblasts cell line was purchased from ATCC. None of the used human cell lines is listed in the NCBI Biosample Database of misidentified cell lines.
HDFs were infected with lenti- and retro-viruses at high titer, sufficient to infect the vast majority of HDFs so that similar results were obtained in experiments with and without antibiotic resistance selection: results in Fig. 7a, e, f and Suppl. Fig. 7b, c, d were obtained without selection, elsewhere else with selection. The list of shRNA vectors, siRNAs, primers and antibodies is provided in Supplementary Table 3. Transient transfection and promoter activity assays were also as described 57 (link) using the pG13-p53 Luc plasmid as reporter 63 (link).
CAFs strains stably infected with a doxycyclin inducible lentiviral vector for myc-tagged CSL in parallel with empty vector control were treated for 5 days with Doxycyclin (500 ng/ml) prior to RT-qPCR and immunoblot analysis. For in vivo assays, CAFs (strain#2) were infected with a lentiviral vector for constitutive CSL expression in parallel with empty vector control, followed, 7 days after infection, by injection into mice with admixed DsRed-expressing SCC13 cells.
For disruption of the p53 gene, the 20 nt CRISPR RNA sequence (ACTTCCTGAAAACAACGTTC) targeting the end of exon 2 of human TP53 gene, was selected as guide RNA (sgRNA) from the published genome-scale sgRNA library on the basis of being close to the beginning of the coding region and predicted minimal off-target probability 64 (link). The corresponding oligonucleotide was cloned into lentiCRISPR vector followed by lentivirus production in 293T as previously described 64 (link). HDFs were infected with the resulting virus, following, 24 hours after infection, by selection for the virally-transduced puromycin resistance gene. 7 days after selection, stably transduced cells (approximately 1000 cells, i.e. 5% of the originally infected cells) were pooled and expanded prior to further analysis in comparison with parental HDFs. The same lentiCRISPR vector was used to target p53 in two other HDF strains with similar efficacy.
Treatment of HDFs with Jagged-1 ligand was as previously reported 57 (link), using Rabbit Anti-Human IgG (Sigma-l2011) plus/minus rhJagged1 Fc chimera (R&D systems; 1277-JG) for coating of dishes. HDFs were treated with the following growth factors / cytokines at the indicated concentrations every 24 hours for 3 days: SHH at 2 µg/ml, CTGF at 200 ng/ml, HGF, FGF-2, ACTIVIN-A, PF4/CXCL4, IL-6, MCP1/CCL2, IL-10 and SDF1/CXCL12 at 100 ng/ml, PDGF-BB at 50 ng/ml, IL-4 at 25 ng/ml, IL-1 β and TGF- β3 at 10 ng/ml final concentration.
Procopio M.G., Laszlo C., Labban D.A., Kim D.E., Bordignon P., Jo S., Goruppi S., Menietti E., Ostano P., Ala U., Provero P., Hoetzenecker W., Neel V., Kilarski W., Swartz M.A., Brisken C., Lefort K, & Dotto G.P. (2015). Combined CSL and p53 downregulation promotes cancer-associated fibroblast activation. Nature cell biology, 17(9), 1193-1204.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
2

Isolation and Culture of Rat and Human Islets

Cited 6 times
Rat islets were isolated from pancreases of P5 Sprague Dawley rats (Charles River) as previously described12 (link) except using Liberase TL (Roche) for pancreas digestion. Hand-picked islets were cultured at 37 °C in 10 cm non-adherent cell culture dishes (500 islets/dish) in islet basal medium: RPMI 1640 medium with GlutaMAX (Gibco), 11 mM glucose, 10% fetal bovine serum (FBS), 1% Penicillin/Streptomycin.
Human pancreatic islets were obtained through the European Consortium on Islet Transplantation, (ECIT), Islets for Basic Research Program. Human islets were cultured at 24 °C in 10 cm non-adherent cell culture dishes (500 islets/dish) in CMRL medium with 2% glutamine, 10% FBS, 10 mM HEPES and 1% Penicillin/Streptomycin. Human islets used in this study were obtained from three normal non-diabetic donors, two male and one female, ranging in age 18–59 years with a body mass index of 20–29 kg/m2.
Phelps E.A., Cianciaruso C., Santo-Domingo J., Pasquier M., Galliverti G., Piemonti L., Berishvili E., Burri O., Wiederkehr A., Hubbell J.A, & Baekkeskov S. (2017). Advances in pancreatic islet monolayer culture on glass surfaces enable super-resolution microscopy and insights into beta cell ciliogenesis and proliferation. Scientific Reports, 7, 45961.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
3

Islet Isolation for Pancreatic Transplant

Cited 4 times
Islets were isolated by pancreatic perfusion with Liberase TL (Roche), for 10 min of digestion at 37°C with gentle shaking and ultrapure (80 to 90%) islet separation from acinar using standard Ficoll gradients (1.108, 1.096, 1.069, and 1.037; Mercodia). Islets were counted using the standard IEQ method and dithizone staining. Two to 3 days after isolation, 600 IEQs were aliquoted in 10 μl of medium and mixed with PEG-RGD gel component just before in situ gelation at the site of transplant. Transplant recipients were monitored for nonfasting blood glucose levels. An IPGTT was performed before sacrifice. At sacrifice, graft recipients were lectin-perfused, as described above. Grafts were additionally stained for insulin (DAKO) using traditional histological techniques with incubation times for permeabilization [Triton X-100 (1 μl/ml) in PBS], blocking (goat serum; BioGenex), and antibody staining extended to 24 hours each to allow whole-graft infiltration.
Weaver J.D., Headen D.M., Aquart J., Johnson C.T., Shea L.D., Shirwan H, & García A.J. (2017). Vasculogenic hydrogel enhances islet survival, engraftment, and function in leading extrahepatic sites. Science Advances, 3(6), e1700184.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
4

Isolation and Analysis of Murine Skin Cells

Cited 4 times
Preparation of adult mice backskins for isolation of keratinocytes and staining protocols were done as previously described (Nowak and Fuchs, 2009 (link)). Briefly, subcutaneous fat was removed from skins with a scalpel, and skins were placed dermis side down on trypsin (Gibco) at 37 °C for 45 minutes. Single-cell suspensions were obtained by scraping the skin to remove the epidermis and hair follicles from the dermis. Cells were then filtered through 70mm, followed by 40mm strainers. Cell suspensions were incubated with the appropriate antibodies for 30 minutes on ice. The following antibodies were used for FACS: α6-integrin (BD Pharmingen), CD34 (eBiosciences) and Sca-1 (eBiosciences). DAPI was used to exclude dead cells. Cell isolations were performed on FACS Aria sorters running FACS Diva software (BD Biosciences). For EdU incorporation experiments, staining was performed using Click-iT EdU Alexa Fluor 488 Flow Cytometry Kit (Life Technologies) per manufacturer’s instructions. FACS analyses were performed using LSRII FACS Analyzers and results were analyzed with FlowJo software.
For analysis of immune cells at the wound site, wound tissue was isolated from the backskin, keeping margins as close to wound as possible. Tissue was minced in media (RPMI with L-glutamine, Sodium pyruvate, acid free HEPES, Penicillin and streptomycin) then Liberase TL (Roche) was added (25μg/ml) and tissue was digested for 90 minutes at 37°C while shaking gently. The digest reaction was stopped by addition of 20ml of 0.5M EDTA and 1ml of 10% DNase solution. Cells were passed through a 70mm strainer and stained with the following antibodies from eBiosciences: Ly6c-FITC 1:100, Ly6g-PE 1:200, CD11c-PECy7 1:150, CD11b-PacBlue 1:300, MHCII-AF700 1:300, CD45-A780 1:100, CD64-PerCP-Cy5 1:200, TCRβ-PCRP 1:200, γδTCR-APC 1:400. Dead cells were excluded using a LIVE/DEAD Fixable Blue Dead Cell Stain Kit (Molecular Probes), for UV excitation. FACS analyses were performed using LSRII FACS Analyzers and results were analyzed with FlowJo software.
Keyes B.E., Liu S., Asare A., Naik S., Levorse J., Polak L., Lu C.P., Nikolova M., Pasoli H.A, & Fuchs E. (2016). Impaired Epidermal to Dendritic T-Cell Signaling Slows Wound Repair in Aged Skin. Cell, 167(5), 1323-1338.e14.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols
5

Generation of Regulatory T Cells from Naive CD4+ T Cells

Cited 4 times
CD4+ T cells were sorted by magnetic separation (CD4+ pre-enrichment kit, Stem Cell Technologies) from splenocytes of FoxP3-GFP mice. Naïve CD4+CD62LhiFoxP3-GFP− T cells were further sorted by FACs. For MLN DCs, MLNs were digested in RPMI1640 containing DNaseI (20 mg/ml) and Liberase TL (0.33 mg/ml; both from Roche) followed by incubation in PBS/2% BSA/10 mM EDTA. Filtered cell suspensions were enriched for DCs using an Optiprep gradient (SIGMA) and CD11c+ CD103+ and CD103− DCs further sorted by FACS. To prepare intestinal DCs, mice were first injected subcutaneously with B16 cells secreting Flt3-L 27 (link) to increase yield of DCs. Lamina propria cells were prepared as described previously 15 (link) and DCs enriched and FACS sorted as for MLN DCs. Naïve spleen T cells and MLN DCs were co-cultured in either RPMI 1640 medium supplemented with 10 % fetal bovine serum and 10 mM HEPES, or in serum free X-VIVO 15 medium (LONZA). Both media also contained 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin and 50 μM 2-β-mercaptoethanol. Cells were cultured in 500 μl volume containing 1–2 × 104 DCs and 2.5–5 × 104 naïve CD4+ T cells (1:5 DC:T cell ratio), in the presence of 0.5 μg/ml anti-CD3 antibody (145-2C11; BD Biosciences). Additional cytokines used were recombinant active-TGF-β1 (0.5 ng/ml) and purified human latent TGF-β (2 ng/ml; both from R&D Systems). Where stated cells were cultured in presence of 40 μg/ml blocking anti-TGF-β1, 2, 3 antibody (1D11; R&D Systems) or all-trans retinoic acid (100 nM; SIGMA). Cells were cultured for 4–5 days before analysis of Treg generation assessed by GFP expression.
PAÏDASSI H., ACHARYA M., ZHANG A., MUKHOPADHYAY S., KWON M., CHOW C., STUART L.M., SAVILL J, & LACY-HULBERT A. (2011). Preferential Expression of Integrin αvβ8 Promotes Generation of Regulatory T Cells by Mouse CD103+ Dendritic Cells. Gastroenterology, 141(5), 1813-1820.
+ Open protocol
+ Expand Check if the same lab product or an alternative is used in the 5 most similar protocols

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!

🧪 Need help with an experiment or choosing lab equipment?
 I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
1. Find protocols
2. Find best products for an experiment
3. Validate product use from papers
4. Check Product Compatibility
5. Ask a technical question
Want to copy this response? Upgrade to Premium to unlock copy/paste and export options.