We Dissect Protocols

Nucleofector kit 5

Manufactured by Lonza
321 citations
Sourced in Germany, United States, Switzerland, United Kingdom, France
About the product

The Nucleofector Kit V is a laboratory equipment product designed for the transfection of cells. It provides the necessary reagents and protocols to efficiently deliver nucleic acids, such as plasmids or siRNA, into a variety of cell types using the Nucleofector technology.

Automatically generated - may contain errors

Market Availability & Pricing

The status of the Nucleofector Kit 5 is unclear. Lonza does not provide definitive information on its current availability or whether it has been replaced by a newer model. As the manufacturer, Lonza would be the best source for the most up-to-date details on this product. If you require operating instructions, safety data sheets, or information on authorized distributors, please consult with Lonza directly.

Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.

Is this product still available?

Get pricing insights and sourcing options

321 protocols using «nucleofector kit 5»

1

CRISPR-Mediated Deletion of ASO-1570 Site

2025
U87MG and MDA-MB231 cells stably expressing Cas9 were Nucleofected, using Nucleofector Kit V (LONZA), with two sgRNAs flanking the ASO binding site (Supplementary Data 7b). For each of the two sgRNA a separate RNP mix was obtained by mixing 16ug of sgRNA with 20ug of Cas9 (IDT) and 200pmol of specific HDR-enhancer oligo (IDT), and incubated for 30 min at room temperature. 2×105 cells were then resuspended in 100ul of supplemented nucleofection solution (LONZA), combined with the Cas9-sgRNA mixes, and nucleofected in a Nucleofector 4D (LONZA), with cell line specific programs (MDA-MB231: CH-125, U87: CS-126). The cell-RNP mix was then plated into 24 well plates. 4 days later cells were dissociated into single cell suspension and replated at low concentration (~100–1000 cells per 10 cm2 plate). Cell colonies were picked approximately 2 weeks following plating and reseeded into 48 well plates. Colonies were expanded once before screening for the deletion of the ASO-1570 site by RT-PCR with primers listed in Supplementary Data 7c. Clones homozygous for the deletion were then verified by Sanger sequencing, and those with similar morphologies, TRA2β-PE splicing, and baseline proliferation rates compared to parental cell lines were picked for further analysis.
+ Open protocol
+ Expand
2

Efficient Gene Knockdown and Editing in LCLs

2024
For knockdown experiments, ~2 million control LCLs were nucleoporated with 300 nM targeting siRNA or Non-Targeting siRNA#1 (Silencer Select, Invitrogen), using program X05 on Nucleofector I or X005 on Nucleofector II, and Cell Line Nucleofector Kit V (Lonza), and cells collected after 72–75 h. In experiments comparing single and double knockdowns, 200 nM of targeting siRNAs or Non-Targeting siRNA#1 was used in single knockdowns, whereas 150 nM of each siRNA was used for double knockdowns. For experiments with nuclear TRM editors, ~2 million LCLs were nucleofected with a mix of 95% crRNA encoding pU6-PspCas13b plasmid and pCMV-dCas13b-METTL3-NLS or dCas13b-METTL3mut-NLS plasmid at 1:2 molarity, and 5% pmaxGFP plasmid (Lonza) at a final amount of 2 μg plasmid DNA per nucleofection, using program X05 on Nucleofector I and Nucleofector Kit V (Lonza), and cells harvested after 96 h. For experiments using the nuclear dCasRX-ALKBH5 eraser, ~2 million LCLs were nucleofected with a mix of 95% crRNA encoding pXR003 plasmid and pMSCV-dCasRx-ALKBH5-PURO plasmid at a 1:1 ratio of DNA and 5% pmaxGFP plasmid at a final amount of 2 μg plasmid DNA per nucleofection using kit and program as above, and cells harvested after 72 h.
+ Open protocol
+ Expand

Corresponding organizations : Cleveland Clinic Lerner College of Medicine, Cleveland State University, Hospital for Sick Children, University of Toronto

3

Lipofection and Nucleofection for Cellular Transfection

2024
Lipofection
was applied
to transfect all HEK293-derived cells. Prior to transfection, cells
were plated in 6-well plates and grown to ∼80% confluence.
Then the pCAG-Flpo helper vector and NF-circuit or MONARCH donor vectors
were cotransfected at a 1-to-1 ratio with a final mass of 2.5 μg
per well. The vectors were first incubated with 3.75 μL of Lipofectamine
3000 (Invitrogen, L3000-015) in OPTI-MEM media (Gibco, 31985062) for
15–30 min. The resulting DNA-lipid complex was then pipetted
onto the cell culture. Cells were then incubated for at least 24 h
before refreshing media. Appropriate drugs for selection were added
72 h post-transfection. Drug selection lasted for at least 14 days
before FACS cell sorting. We used 10 μg/mL Blasticidin with
10 μg/mL ganciclovir for all engineered HEK293 cell selection.
For Vero E6 and all its derived cell sublines, Nucleofection was
performed based on the manufacturer’s instructions and recommendations.
Briefly, newly thawed Vero E6 cells were plated in a T-25 flask and
subcultured 3–5 days before Nucleofection. Next, cells were
harvested by adding trypsin and counted using a Cellometer Auto T4
(Nexcelom Bioscience). Around 1 × 106 cells were collected
and centrifuged at 200g for 10 min at room temperature.
Then the supernatant was removed, and cells were resuspended in 100
μL room-temperature Nucleofector Kit V (Lonza, VCA-1003) solution.
The LPutopia-8/espCas9 or pCAG-Flpo/MONARCH donor vector combinations
were cotransfected at a 1-to-1 ratio with a final mass of 2 μg
per sample. The cell/DNA suspension was transferred into the certified
Nucleofector cuvette and the V-001 program of Nucleofector 2b Device
(Lonza, AAB-1001) was applied. Finally, transfected cells were buffered
with fresh media and gently transferred into a freshly prepared 6-well
plate. Drug selection started 24–48 h postnucleofection and
lasted for at least 14 days before FACS cell sorting. We used 4 μg/mL
of puromycin for Vero E6 LP cell selection and 2 μg/mL Blasticidin
with 5 μg/mL ganciclovir for Vero E6MONARCH cell selection.
For all the transient transfection assays, engineered HEK293 cells
were seeded and induced 72 h prior to plasmid transfection by Lipofectamine
3000 as described above. Engineered Vero E6 cells were collected after
72-h preinduction for nucleofection with plasmids and then plated
back into 6-well plates for incubation. For both cases, corresponding
Dox induction levels were maintained during plasmid incubation, and
cells were typically incubated for 72 h prior to flow cytometry or
cell viability assays.
+ Open protocol
+ Expand
4

Ectopic Ovo ChIP-seq in OSCs

2024
For ectopic Ovo ChIP-seq, >30 x 10 6 OSCs (n=2) were nucleofected with a ovo-B-FLAG construct using 0.5-0.8 μg per million cells, Nucleofector Kit V (Lonza, VVCA-1003), T-029 program on NucleofectorTM 2b Device (Lonza), and crosslinked 48 hours later by covering cells in 1% formaldehyde (FA) solution (50mM Hepes-KOH, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 1% FA) for 10 min at room temperature. Cell lysis was performed as described in 79 . Sonication was performed with 15-18 cycles of 10 sec ON and 60 sec OFF (Fisherbrand™ Q705 Sonicator, 418-21 probe) in 3 mL of LB3 buffer (10 mM Tris-HCl, pH 8; 100 mM NaCl; 1 mM EDTA; 0.5 mM EGTA; 0.1% Na-Deoxycholate; 0.5% N-lauroylsarcosine; in 7 ml conical polypropylene tube) to shear DNA into 100-500 bp fragments. Chromatin immunoprecipitation was performed using 5-10 μg of primary mouse monoclonal ANTI-FLAG® M2 antibody (Merck, F1804-200UG) in 250 μL LB3 with 1% Triton X-100 overnight at 4 °C. Crosslinks were reversed by incubation at 65 °C for 16 h. Proteins and RNA were enzymatically digested. DNA purification was performed using phenol-chloroform extraction and ethanol precipitation. The purified ChIP DNA and 220 ng of whole cell extract DNA were used to prepare ChIP-seq libraries using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB, E7645S) with PCR amplifications carried out for 16 cycles. The ChIP-seq libraries were assessed for fragment size distribution using Agilent 2100 bioanalyzer on a High Sensitivity DNA Kit, quantified with KAPA Library Quantification Kit for Illumina (Kapa Biosystems, KK4873), and sequenced on a NovaSeq 6000 System with 2 × 150 bp reads on SP flow cell.
+ Open protocol
+ Expand

Corresponding organizations : University of Cambridge

5

Transfection of Tardigrade Fusion Proteins

2024
Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA) or ordered from TwistBiosciences. Full nucleotide sequences of fusion proteins are provided as supplementary information (Supplementary file 2). Plasmids were transfected into human U2OS cells (purchased from ATCC ref ATCC-HTB-96 and regularly tested for mycoplasma contamination) by Amaxa electroporation with Nucleofector Kit V (Lonza) and plated in six-well plates containing glass slides.
+ Open protocol
+ Expand

Top 5 most cited protocols using «nucleofector kit 5»

1

Macrophage Transfection Optimization

RAW264.7 macrophages (American Type Culture Collection, Manassas, VA) were grown in RPMI 1640 medium (Wisent, St. Bruno, Canada) supplemented with 5% heat-inactivated fetal bovine serum (Wisent) at 37°C under 5% CO2. For siRNA transfection, cells were trypsinized from a confluent T25 flask, spun down, and electroporated with Nucleofector Kit V (Lonza, Basel, Switzerland) according to the manufacturer's instructions. Briefly, the cell pellet was resuspended in 100 μl of Nucleofector Solution V containing 1 μM of APPL1 siRNA (L-053641; Dharmacon, Lafayette, CO), OCRL siRNA (L-064801), Inpp5B (L-057616), or scrambled siRNA (D-001810) and electroporated with program D-32 on the Nucleofector I system (Lonza). Cells were used 48 h after siRNA treatment. For cDNA transfection, cells plated on glass coverslips were transiently transfected with FuGene HD (Roche, Indianapolis, IN) according to the manufacturer's instructions. Each well of a 12-well plate was treated with 2 μg of plasmid cDNA and 6 μl of FuGene HD. Cells were generally used 12–18 h after transfection.
The plasmids encoding GFP-APPL1, RFP-APPL1, OCRL-GFP, Inpp5B-RFP, and Inpp5B-GFP were described earlier (Erdmann et al., 2007 (link); Zoncu et al., 2009 (link)). The Akt1-GFP construct was generously provided by J. Brumell (Hospital for Sick Children, Toronto, Canada). The RAW264.7 macrophages stably expressing mCherry-Actin and the plasmids encoding Rab5-RFP, 2FYVE-RFP, constitutively active Rab5-GFP, dominant-negative Rab5-GFP, dominant-negative Rab5-myc, Rab7-GFP, 2PH-PLC-GFP, and PH-Gab2-GFP were described earlier (Vieira et al., 2003; (link) Bohdanowicz et al., 2010 (link)). Constitutively active Rab5-mCherry and dominant-negative Rab5-mCherry were both made by subcloning the Rab5 fragment into pmCherry-C1 (Clontech, Mountain View, CA) using XhoI and BamHI.
+ Open protocol
+ Expand

Corresponding organizations : Hospital for Sick Children, Yale University

2

Cultured Mammary Epithelial Cells for Live-Cell Imaging

MCF10A human mammary epithelial cells were grown at 37 °C and 5% CO2 in DMEM F12 (Invitrogen) supplemented with 5% donor horse serum (Invitrogen), 20 ng ml−1 epidermal growth factor (Peprotech), 10 μg ml−1 insulin (Sigma), 0.5 μg ml−1 hydrocortisone (Sigma), 0.1 μg ml−1 cholera toxin (Sigma), and 100 units ml−1 penicillin/streptomycin. For stable expression of paxillin-mEmerald or paxillin-mCherry, recombinant lentivirus was prepared by transient transfection into HEK-293T cells and used to transduce MCF10A cells as previously described12 . Stable cell lines were selected in 200 ng ml−1 G418 and 380 ng ml−1 hygromycin and sorted on a FACSAria II cell sorter (BD Biosciences) for paxillin-mEmerald or paxillin-mCherry expression. Expression of paxillin-mEmerald or paxillin-mCherry was induced with 200 ng ml−1 doxycycline in growth media for one day prior to experimentation. Transient transfection was with Lonza Nucleofector Kit V (program T024). Talin fluorescent protein conjugates were co-transfected with shRNA targeting endogenous MCF10A talin1.
For all experiments, cells were replated on fibronectin-conjugated silicon wafers and cultured overnight before live-cell imaging, fixation, or cell roofing. Except for microtubule imaging, cells were plated on wafers with 500-nm silicon oxide and fixation was performed in 2% paraformaldehyde for 20 minutes. For cell membrane imaging, the dorsal cell membrane was removed through cell roofing according to previously described protocols13 (link). Briefly, cells were swelled in ice-cold hypotonic buffer (15 mM KCl, 15 mM Hepes, 1 mM CaCl2, 1 mM MgCl2, pH 7.4) for 4 minutes. Swollen cells were then sonicated with a probe-type sonicator (Microson XL2000; Misonix) using a short pulse (<1 s, Power Setting 8) with the sonicator probe (1/8” diameter) approximately 3 mm above the cells. Following sonication, the remaining ventral plasma membranes were rinsed once in PBS and fixed. Membranes were labeled with fluorescent dye post-fixation by incubating in 1 μM Vybrant DiO (Invitrogen) in PBS for one hour at room temperature. Rho kinase inhibition was with 10 μM of the inhibitor Y-27632 (Cayman Chemical) in growth media. For the microtubule imaging, cells were plated on wafers with 1.9 μm silicon oxide overnight and fixed by incubating in 0.25% glutaraldehyde for 30 seconds and then transferring them to a solution of 0.25% glutaraldehyde with 0.1% Triton X-100 in PBS. Cells were then rinsed with PBS and covered with a freshly prepared drop of 0.2% sodium borohydride in PBS, which was exchanged three times over 30 minutes. This was followed by two rinses with PBS and a 10 minute incubation with a solution of PBS, 2% BSA, and 0.1% Triton X-100. Microtubules were labeled with rat monoclonal anti-tubulin antibody (AbD Serotec) and Alexa488-conjugated anti-rat secondary antibody (Invitrogen).
+ Open protocol
+ Expand

Corresponding organizations : University of California, San Francisco, Florida State University, National High Magnetic Field Laboratory, University of California, Berkeley

3

CRISPR-Mediated Genetic Manipulation in Plasmacytoma Cell Lines

Both CH12 and PCT 7134 plasmacytoma cell lines SA−/− and SApartial knock out and CTCF ZF9-11 knock in mutants were generated using CRISPR/Cas9 technique. Suitable sgRNA targets were identified using Optimized CRISPR Design (http://crispr.mit.edu) and cloned into pSpCas9(BB)-2A-GFP (PX458) and pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene) as directed in PMID:24157548. For SA−/− a pair of gRNAs (GCGCTGCAATGGGAACCA and CCTTGAGTTAACCTGGGACCA) and SApartial (GCGCTGCAATGGGAACCA and CACCTGAGCACTACGCTGTGG) were cloned in pX458 and introduced into CH12 cell line using Nucleofector Kit V according to the manufacturer's instructions (Lonza). Twenty-four hours post-nucleofection, GFP positive cells were collected using a BD FACSAriaIII (Becton Dickinson) flow cytometer and seeded at a density of 1 cell/well in 96-well plates. Screening for full or partial deletions of SA region used oligonucleotides are listed in the Key Resources Table.
CH12 ZF9-11 mutant was generated replacing endogenous CTCF exons 7 to 10 with a cDNA carrying point mutations in ZF 9, 10 and 11 (as shown in our previous paper Nakahashi H et al 2013 (link)). A single sgRNA (CTGCGACAAGACCTTCCGCC) cloned in px330 vector and a DNA donor vector were introduced into CH12 as above. The donor vector included 500–1500 bp homology arms and a PGK_ puromycin cassette to select for targeted clones. After 36h cells were treated with puromycin (0.8 µg/ml, Sigma). The day after puromycin was wash out and limiting dilution was performed in fresh media. Individual clones were picked and genomic DNA was extracted (Biotool™). Genotyping and sequencing were done by PCR using several locus-specific pairs of primers listed in the Key Resources Table.
+ Open protocol
+ Expand

Corresponding organizations : National Institute of Arthritis and Musculoskeletal and Skin Diseases, Baylor College of Medicine, Stanford University, National Institutes of Health, National Human Genome Research Institute, Jackson Laboratory, University of Connecticut, National Institute of Allergy and Infectious Diseases, Rice University, Center for Theoretical Biological Physics, ShanghaiTech University, Center for Cancer Research

4

Rat Pheochromocytoma Cell Culture and Neuron Transfection

Rat pheochromocytoma, PC12, cells were cultured as described previously (Ha et al., 2008 (link)), except that media for undifferentiated cells was supplemented with 5 % FBS and 10% CS (Hyclone). For co-localization studies, PC12 cells were co-transfected with the siRNA nucleotide to the 3′ UTR of the IC-2C gene, TrkA-GFP, and IC-2C-mRFP wild type or mutant plasmids by electroporation using Nucleofector Kit V and program U-029 (Lonza). Approximately 2 million cells were used per transfection. Rat embryonic cortical and hippocampal neurons (E17-19, of either sex) were prepared as described previously (Goslin et al., 1998 ; Ha et al., 2008 (link)) except that the cells were inverted on 25 mm diameter coverslips in Neurobasal media supplemented with B-27 and Glutamax (Invitrogen) without glia (Brewer et al., 1993 (link)). Embryonic E17-19 cortical and hippocampal neurons in suspension were transfected with siRNA oligonucleotides to the UTR regions of IC-1 or IC-2 using electroporation with the Rat Neuron Kit and setting O-030; ~5.5 million cortical neurons were used per transfection and were plated for biochemical assays on a 6 cm dish, and 4 million hippocampal neurons/transfection were plated on two 6 cm dishes containing coverslips. Neurons grown on coverslips for 3–6 days in vitro (DIV) were transfected with fluorescent-tagged proteins for live cell imaging using the CaPO4 for Mammalian Cells Transfection Kit (Clontech) and the method of (Jiang and Chen, 2006 (link)).
+ Open protocol
+ Expand

Corresponding organizations : University of Virginia, Division of Chemistry, Louisiana State University Health Sciences Center New Orleans, University of California, San Francisco

5

Generation and Characterization of HLA-A*0201 Single-Chain Tetramers

HLA-A*0201 SCTs were generated as previously described (22 (link)). For AT-SCT generation, synthetic DNA oligonucleotides (Integrated DNA technologies, Coralville, IA) encoding 10-mer antigenic peptides extended at N-terminus were ligated into the SCT vectors at restriction sites specifically designated for peptide sequence shuffling. Multiple amino acid residues were introduced at the N-terminus of optimal 9-mer peptide to generate AT-SCT. For NLV (CMV pp65), constructs were made containing the naturally occurring amino acid residue (ANLV) or amino acids with bulky non-polar (YNLV) and uncharged polar (NNLV) R groups as well as non-bulky uncharged polar (GNLV) R group. The ANLV construct was poorly expressed on the cell surface and not further studied; all other AT-SCT constructs were expressed on the cell surface at levels similar to the SCT. For IMD (G209-2M), constructs containing the naturally occurring amino acid residue (TIMD) and, for comparison with the CMV system, an AT-SCT construct expressing the bulky uncharged polar (NIMD) was made. A construct containing human β2m and HLA-A*0201with no covalently linked peptide, refer to as single chain dimmer (SCD), was also generated. Generation of disulfide trap SCT (SCT dt) molecules was performed as previously described (22 (link)). All construct were verified by DNA sequencing. K562 cells (ATCC, Manassas, VA) were transfected with constructs using Nucleofector kit 5 (Lonza, Basel, SZ) and stable cell lines selected and maintained in 0.5ug/mL geneticin (Life technologies, Grand Island, NY). Transfectants were assessed for HLA-A2 expression using the monoclonal antibody BB7.2 (Serotec, Kidlington, UK). Expression of NLV (CMV pp65)/A*0201 and IMD (G209-2M)/A*0201 peptide complexes on the surface of K562 transfectants was assessed using PE-conjugated TCR multimers ((23 (link)), Altor Bioscience, Miramar, FLA) as per manufacturers’ instructions.
+ Open protocol
+ Expand

Corresponding organizations : Washington University in St. Louis

The spelling variants listed above correspond to different ways the product may be referred to in scientific literature.
These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!

🧪 Need help with an experiment or choosing lab equipment?
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
1. Protocol search & design
(papers, patents, application notes)
2. Protocol validation
(from literature and MDAR)
3. Lab Product search
4. Product validation from literature
5. Troubleshoot product/ protocol
6. Instant figure generation New
Want to copy this response? Create your account to unlock copy/paste and export options.