Genomic Mini kit

Genomic DNA was isolated from P. gingivalis clinical strains using Genomic Mini kit (A&A Biotechnology). The fimA and fimB genes were amplified using Phusion™ High-Fidelity DNA Polymerase (Thermo Fischer) with primers: fimA uni-F (AAGTTTTTCTTGTTGGGACTTGC), fimA uni-R (AACCCCGCTCCCTGTATTCCGA) (28 (link)) and fimB F (ATCGTATCGGTGCTGATCTTACTCG), fimB R (TCTGCATATTGTTGCACTACGTCCC). The amplification cycles were as follows: 98°C 30s initial denaturation, then 35 cycles of denaturation, annealing and extension 98°C 10s, 68°C 30s and 72°C 30s, respectively, and final extension 72°C, 10 min, 4°C hold. PCR products were run in 1% agarose gels containing ethidium bromide and bands corresponding to the fimA or fimB gene size were extracted from the gel using GeneJET Gel Extraction Kit (Thermo Fischer). The fimA or fimB gene was then cloned into the pJET plasmid (Thermo Fischer). Recombined plasmids were propagated in E. coli DH5α strain and isolated using GeneJET Plasmid Miniprep Kit (Thermo Fischer). All kits were used according to manufacturer’s instructions. Isolated plasmids were sequenced by Genomed, Poland and results were analyzed using Needle (EMBOS-EBI) and Chromas Lite (Technelysium Pty Ltd) programs.

Genomic DNA from each bacterial isolate was extracted by using a lysostaphin-based extraction protocol with the Genomic Mini Kit (A&A Biotechnology, Gdansk, Poland). Detection of the genes blaZ, mecA and mecC was performed by PCR reaction in a total volume of 15 µL, containing 7.5 µL REDTaq^® ReadyMix™ PCR Reaction Mix (Merck, Darmstadt, Germany) and 1 µL of bacterial genomic DNA, by using specific primers (Table S1) and temperature–time procedures as previously published [12 (link),32 ]. The following controls were included in all amplification reactions: S. aureus ATCC 29213 (blaZ-positive S. aureus), S. aureus ATCC BAA-1707 (mecC-positive S. aureus), S. aureus ATCC 25923 (mecA, blaZ-negative S. aureus), S. epidermidis ATCC 12228 (mecA, mecC-negative S. epidermidis) and negative control (water).

The Genomic Mini Kit (A&A Biotechnology, Gdynia, Poland) was applied for DNA isolation, according to the manufacturer’s protocol. In order to confirm the DNA isolation accuracy and to avoid false-negative results, the concentrations of all DNA samples were initially checked spectrophotometrically (Photometer, Eppendorf, Germany). DNA samples were then unified in terms of their concentration for PCR-RAPD application and stored afterwards at 4 °C before further use in PCR for MBL gene detection and the presence of the virulence genes.

Total RNA was isolated using the RNeasy Mini Kit (Qiagen), and ~ 1500 ng of RNA was taken for cDNA synthesis. The levels of mRNA transcripts for MRGPRD, PGC-1α, TFAM, and β-actin were determined using gene-specific primers and Taq-Man hydrolysis probes. The Genomic Mini kit (A&A Biotechnology) was used for DNA isolation. DNA (~ 100 ng) was used for single real-time polymerase chain reaction (PCR) to determine the copy number of the tRNA_Leu mitochondrial gene relative to the β2-microglobulin nuclear gene (SybrGreen detection system). Real-time PCR analyses were performed in a LightCycler 480 (Roche). The results were quantified using the ΔΔCt method, with β-actin as the internal control. Sequences of primers and probes are given in Supplementary Table S1.

Detection of adeB and abeM genes was carried out with a singleplex PCR. The total DNA of the clinical isolates was extracted using a Genomic Mini Kit (A&A Biotechnology, Gdynia, Poland). PCR was performed by using the Hypernova polymerase (Blirt, DNA, Gdańsk, Poland) with the following amplification parameters: 95 °C for 4 min, following 25 cycles of 30 s at 95 °C, annealing 30 s at 55 °C (adeB gene) and at 54 °C (abeM gene), 45 s at 72 °C and a final extension of 3 min at 72 °C. Sequences of the primers are presented in Table 3.

Genomic DNA was isolated with the Genomic Mini Kit (A&A Biotechnology, Gdynia, Poland) according to the manufacturer's instructions. DNA was stored at -20°C for further analyses.

Two strains of P. agardhii were isolated from the bloom sample collected from the SDR on October 16, 2012. The isolates were identified using microscopic analysis (Komárek and Anagnostidis 2005 ) and molecular methods. Single trichomes of P. agardhii were picked up and purified by multiple transfers to agar (1.0 % bacterial agar) and liquid Z8 medium (Kotai 1972 ). The isolates were cultivated at 22 °C, and continuous light of 5 µE m²/s provided by standard cool white fluorescent lamps. The strains, CCNP1325 and CCNP1326, were deposited in the Culture Collection of Northern Poland at the Institute of Oceanography, University of Gdańsk. Genomic DNA was extracted with Genomic Mini Kit (A&A Biotechnology), according to the manufacturer’s instructions. 16S rRNA gene cyanobacteria-specific primers were used: CYA359F (Nübel et al. 1997 (link)) and 23S30R (Lepére et al. 2000 (link)). The PCR was performed according to Koskenniemi et al. (2007 (link)) with minor changes (annealing temperature changed to 57 °C). The amplified PCR products were purified using Clean-up Kit (A&A Biotechnology). Nucleotide sequences have been deposited in the GenBank database under the accession numbers KF976399 for CCNP1325 and KF976400 for CCNP1326.