Sucrose
Sucrose is a disaccharide composed of glucose and fructose. It is commonly used as a laboratory reagent for various applications, serving as a standard reference substance and control material in analytical procedures.
Market Availability & Pricing
Sucrose is a commercialized product from Merck Group and available through authorized distributors. Typical pricing ranges from $46.30 for 25 grams to $562.32 for 10 kilograms.
Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.
Is this product still available?
Get pricing insights and sourcing optionsLab products found in correlation
4 605 protocols using «sucrose»
In Vitro Seed Germination and Seedling Culture
Nucleus Fractionation and Immunoblotting
Electroporation-mediated Delivery of Bleomycin and Calcium
Before the experiments, cells were detached from the surface of the plate using trypsinization. After that, cells were centrifuged at 1000 rpm (Biosan, LMC-3000) and resuspended in 1 mL of laboratory-made low conductivity electroporation media (0.1 S/m, 270 mOsm, pH = 7; 242.19 mM sucrose, 5.59 mM Na2HPO4, 1.73 mM MgCl2, 3.00 mM NaH2PO4) for bleomycin electrotransfer and irreversible electroporation. For calcium electroporation, HEPES medium was used. This medium is composed of 10 mM HEPES (Lonza, Basel, Switzerland), 250 mM sucrose (Sigma-Aldrich), and 1 mM MgCl2 (Sigma-Aldrich, Saint Louis, MO, USA) pH 7.1, 0.01 S/m.
An amount of 45 μL of cell suspension (2 million cells/mL) was supplemented with 5 μL bleomycin (200 nM) or calcium (10 mM) suspension. The mixture of this medium was placed in between electrodes and pulsed with electric fields. Then, this suspension was placed in a 6-well plate (TPP, Schaffhausen, Switzerland), incubated for 10 min, and 2 mL of growth media was put on the electroporated cells.
Slime-Producing Bacterial Cultures: Pellicle Formation
Bacterial cultures were diluted to an optical density (OD600) of 0.1 after 8 h of incubation in both MH and LB broth. Subsequently, 2.5 mL aliquots of these cultures were transferred into various materials: (i) borosilicate glass tubes containing MH broth, (ii) borosilicate glass tubes containing LB broth, (iii) polypropylene plastic tubes containing MH broth, and (iv) polypropylene plastic tubes containing LB broth. The cultures were then incubated statically at 37 °C in the dark for 48 h. Visual inspection for pellicle formation was performed after the 48-hour incubation [13 ].
Evaluating Fungal Growth Performance under Nutritional Landscapes
We point‐inoculated each Petri dish (60 × 15 mm diameter) by adding 120 conidia (5 μL of a 24,000 conidia mL−1 conidial suspension) in the center. Each of the 36 diet treatments was replicated three times for each of the eight fungal isolates (N = 864 Petri dishes). After 11 days of growth, each Petri dish was photographed with a camera (Canon EOS 700) in a photo box, ensuring uniform light and focus area and equipped with a reference ruler. Eleven days of growth corresponds to the time when the fastest growing fungus–nutrient combinations had just begun to reach the edge of the Petri dishes, while the slowest growing fungus–nutrient combinations had grown enough to be scored.
Mycelial growth area in square millimeters (Figure
To estimate the effects of P:C diet on the onset of sporulation, we monitored each Petri dish daily for 11 days and used a modified scoring scheme from Fernandes et al. (2010 (link)) where the fungus color was qualitatively evaluated on an eight‐level scale indicating developmental stage from white (hyphal growth) to dark green (mature sporulation). We detail this color scoring scheme in Appendix
We visualized FNN heatmaps using the fields package (Nychka et al., 2021 ) in R (4.3.1) (R Core Team, 2022 ), plotting the response variables growth area (in square millimeters), log10(spore number), and onset day of sporulation across the 36 P:C diet treatments. Red areas indicate high values of response variables and blue areas indicate low values. We set the topological resolution of response surfaces to λ = 0.0005 as a smoothing factor (Shik et al., 2016 (link)) and generated performance isoclines using nonparametric thin‐plate splines. We used least‐square regressions to assess the significance of the linear and quadratic terms (and their linear interaction) for each dependent variable across the P and C diet treatments. These analyses were performed on the mean values across isolates for M. anisopliae (n = 3), M. acridum (n = 3), and M. robertsii (n = 2) used to generate the composite species‐level figures (Appendix
Top 5 most cited protocols using «sucrose»
Dietary Manipulation in C57Bl/6 Mice
Corresponding organizations : University of Cincinnati Medical Center, Cleveland Clinic, University of Cincinnati, Cincinnati Children's Hospital Medical Center
Conditional RNAi Leukemia Modeling
Corresponding organizations : Cold Spring Harbor Laboratory, Ludwig Boltzmann Cluster for Cardiovascular Research, Medical University of Vienna, Johns Hopkins Medicine, Johns Hopkins University, Dana-Farber Cancer Institute, Harvard University, Cincinnati Children's Hospital Medical Center, University of California, San Francisco
Sucrose Snacking Modulates FosB Expression
Corresponding organizations : University of Cincinnati
Optimized Extraction and Quantification of Myeloperoxidase Activity from Mouse Organs
Optimal protein precipitation conditions for MPO were tested by using purified human MPO (1.7 mg/ml; Lee Biosolutions, St. Louis, MO). 0.24, 0.12, 0.06 and 0.03 pmol MPO were precipitated with either acetone or ammonium sulfate as previously described [25] . Recovery of MPO after precipitation was compared to unprecipitated MPO activity using 10-acetyl-3,7-dihydroxyphenoxazine (ADHP, AAT Bioquest, Sunnyvale, CA) as described below.
Corresponding organizations : Massachusetts General Hospital, Center for Systems Biology, Harvard University, McGill University, Jewish General Hospital, Far Eastern Memorial Hospital
Purification of Waddlia chondrophila from Acanthamoeba
Waddlia chondrophila WSU 86-1044, ATCC number VR-1470, was grown at 32°C within Acanthamoeba castellanii ATCC 30010 in 75 cm2 cell culture flasks (Becton Dickinson, Franklin Lakes, USA) with 30 ml of peptone-yeast extract glucose broth. To purify W. chondrophila, amoebae were removed from culture media using a first centrifugation step at 120×g for 10 min. Amoebal debris were next removed from the resuspended bacterial pellet by centrifugation at 6500 x g for 30 min onto 25% sucrose (Sigma Aldrich, St Louis, USA) and then at 32000 x g for 70 min onto a discontinuous Gastrographin (Bayer Schering Pharma, Zurich, Switzerland) gradient (48%/36%/28%). The bacteria clustering in the Gastrographin gradient at a large lower band were collected, centrifuged at 5800 x g and resuspended in PBS twice, and finally stocked at −80°C. The absence of contaminants was confirmed by plating frozen material on Chocolate agar. Since no growth was observed on agar after 72 h of incubation, frozen material was inoculated onto A. castellanii and immunofluorescence was performed using specific anti-Waddlia antibodies as well as DAPI-staining. We observed no DAPI-positive particles that were not stained with the anti-Waddlia antibodies. In addition, a PCR targeting Eubacteria 16S rRNA followed by sequencing was performed with primers FD1 (5′agagtttgatcctggctcag3′) and RP2 (5′acggctaccttgttacgactt3′).
Corresponding organizations : University of Lausanne, Bielefeld University, Queensland University of Technology, University of Zurich
Similar products (other manufacturers)
The spelling variants listed above correspond to different ways the product may be referred to in scientific literature.
These variants have been automatically detected by our extraction engine, which groups similar formulations based on semantic similarity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!