We Dissect Protocols

Sucrose

Manufactured by Merck Group
4 605 citations
Sourced in United States, Germany, United Kingdom, France, Sao Tome and Principe, Canada, Switzerland, Spain, China, Australia, Italy, Macao, Japan, India, Belgium, Poland, Sweden, Ireland, Denmark, Israel, Brazil, Netherlands, Singapore, Mexico, Hungary, Austria, Argentina, New Zealand, Czechia, Finland, Greece
About the product

Sucrose is a disaccharide composed of glucose and fructose. It is commonly used as a laboratory reagent for various applications, serving as a standard reference substance and control material in analytical procedures.

Automatically generated - may contain errors

Market Availability & Pricing

Sucrose is a commercialized product from Merck Group and available through authorized distributors. Typical pricing ranges from $46.30 for 25 grams to $562.32 for 10 kilograms.

Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.

Is this product still available?

Get pricing insights and sourcing options

4 605 protocols using «sucrose»

1

In Vitro Seed Germination and Seedling Culture

2025
Murashige and Skoog (MS) basal media (Duchefa Biochemie, Haarlem, The Netherlands) [59 ] at half strength (1/2MS, 2.2 g L−1) supplemented with 15 g L−1 of sucrose (Sigma-Aldrich, St. Louis, MO, USA) and 7 g L−1 of bacteriological agar (Duchefa Biochemie, Haarlem, The Netherlands) was used as a sowing media. pH was adjusted to 5.7 before autoclaving at 120 °C for 20 min [60 ]. The disinfected seeds were sown in sterile plastic disposable Petri dishes, with 20 seeds in each dish. Seedlings developed under in vitro conditions inside a growth room at 26 ± 2 °C on shelves with a 16 h light (LED lamps)/8 h dark photoperiod and photosynthetic photon flux of 50 molm−2 s−1 for 8 months. Seedlings were subcultured monthly in fresh media.
+ Open protocol
+ Expand
2

Nucleus Fractionation and Immunoblotting

2025
Nucleus-enriched and -depleted fractions were prepared as previously described in ref. 57 (link) with the following modifications. Around 1 g leaves were homogenized in liquid N2 using pre-chilled mortar and pestle followed by homogenization in 5 mL of NIB [250 mM sucrose (Sigma), 10 mM NaCl (ThermoFisher), 15 mM PIPES pH 6.8 (ThermoFisher), 0.8% Triton X-100 (Sigma) and 0.1 mM PMSF (Sigma)] with 1x Protease Inhibitor Cocktail (ThermoFisher) at 4 °C. This extract was centrifuged at 300 x g for 5 min at 4 °C to remove the debris and filtered through a double layer of Miracloth (Sigma). Nuclei-enriched fraction was obtained by centrifuging at 1500 x g for 10 min; its supernatant was nucleus-depleted fraction. For the nucleus-depleted fraction, the supernatant was centrifuged again at 1500 x g for 5 min and 200 µL of the supernatant was collected in a new Eppendorf tube. For the nuclei-enriched fraction, the pellet was washed 3–4 times at 1500 x g for 2 min to remove any residual green color. Both the nuclei-enriched and depleted fractions were mixed with 4x SDS sample preparation buffer for western blot. Immunoblotting (IB) analysis with α-HA (1:5000) (Novus) was performed to track the AGO proteins; α-phosphoenolpyruvate carboxylase antibody (α-PEPC, 1:25,000) (Rockland) and α-histone H3 antibody (1:25,000) (Abcam) were used to ensure depletion and enrichment of nuclei, respectively.
+ Open protocol
+ Expand
3

Electroporation-mediated Delivery of Bleomycin and Calcium

2025
The pulse generator (Amber Charge, Kaunas, Lithuania) was used to generate 280 or 560 V square wave electric pulses. Stainless steel plate electrodes with a 2 mm gap were used as an applicator and the load. For reversible electroporation, 1 square electric pulse with an intensity of 1400 V/cm and duration of 100 μs was used and for irreversible electroporation, 1 square wave pulse with an intensity of 2800 V/cm and duration of 100 μs was employed in the study.
Before the experiments, cells were detached from the surface of the plate using trypsinization. After that, cells were centrifuged at 1000 rpm (Biosan, LMC-3000) and resuspended in 1 mL of laboratory-made low conductivity electroporation media (0.1 S/m, 270 mOsm, pH = 7; 242.19 mM sucrose, 5.59 mM Na2HPO4, 1.73 mM MgCl2, 3.00 mM NaH2PO4) for bleomycin electrotransfer and irreversible electroporation. For calcium electroporation, HEPES medium was used. This medium is composed of 10 mM HEPES (Lonza, Basel, Switzerland), 250 mM sucrose (Sigma-Aldrich), and 1 mM MgCl2 (Sigma-Aldrich, Saint Louis, MO, USA) pH 7.1, 0.01 S/m.
An amount of 45 μL of cell suspension (2 million cells/mL) was supplemented with 5 μL bleomycin (200 nM) or calcium (10 mM) suspension. The mixture of this medium was placed in between electrodes and pulsed with electric fields. Then, this suspension was placed in a 6-well plate (TPP, Schaffhausen, Switzerland), incubated for 10 min, and 2 mL of growth media was put on the electroporated cells.
+ Open protocol
+ Expand
4

Slime-Producing Bacterial Cultures: Pellicle Formation

2025
All isolates were cultured on Congo red Agar (CRA) plates, prepared by adding 0.8 g of Congo red (Sigma, USA) and 36 g of sucrose (Sigma, USA) to 1 L of Brain Heart Infusion (BHI) agar (Oxoid, England). The plates were then incubated for 24 h at 37 °C [12 ]. The production of rough black colonies was identified to distinguish between slime-producing isolates from non-slime-producing ones.
Bacterial cultures were diluted to an optical density (OD600) of 0.1 after 8 h of incubation in both MH and LB broth. Subsequently, 2.5 mL aliquots of these cultures were transferred into various materials: (i) borosilicate glass tubes containing MH broth, (ii) borosilicate glass tubes containing LB broth, (iii) polypropylene plastic tubes containing MH broth, and (iv) polypropylene plastic tubes containing LB broth. The cultures were then incubated statically at 37 °C in the dark for 48 h. Visual inspection for pellicle formation was performed after the 48-hour incubation [13 ].
+ Open protocol
+ Expand
5

Evaluating Fungal Growth Performance under Nutritional Landscapes

2025
We used an in vitro approach (Shik et al., 2020 (link)) to quantify the nutritional blends that maximize pathogen growth performance (radial area) and fitness (timing and amount of spore production) (Figure 2B). By confining fungal isolates to 36 nutritionally‐defined media treatments that systematically varied ratios and concentrations of P and C, we simulated nutritional landscapes within insect hosts where different tissues provide an array of nutritional foraging options (Figure 2C). Eight Metarhizium isolates were inoculated on Petri dishes with 1 of 36 nutritionally defined diets spanning 9 protein: carbohydrate (P:C) ratios (16:1, 8:1, 5:1, 3:1, 1:1, 1:3, 1:5, 1:8, 1:16 P:C) and 4 protein + carbohydrate (P + C) concentrations (4, 8, 20, and 50 g/L P + C). The P:C ratios were chosen to challenge the fungi while still allowing for fungal growth, whereas the concentrations were chosen to go from low‐nutrient conditions conducive to sporulation to high‐nutrient conditions not conducive to sporulation. Diets were prepared by combining 1.6 w/v% of microbiological agar (Sigma‐Aldrich), soluble starch (Sigma‐Aldrich), sucrose (Sigma‐Aldrich), Bacto peptone (Becton Dickinson, BD), Bacto tryptone (BD), Trypticase Peptone (BD), and Vanderzant vitamin mixture (Sigma) at 2% total dry mass. Diet recipes were adapted from the study of Shik et al. (2016 (link)) and are provided in Appendix S1: Table S2. Dry diet ingredients were weighed to the nearest 0.001 g on a scale (Denver Instrument, SI‐234), suspended in 500 mL distilled water, stirred for 5–10 min while the pH was adjusted to 6.5, and then autoclaved at 121°C. If necessary (for higher diet concentrations), we slowly mixed the autoclaved media again using a stirring magnet. Each Petri dish (60 × 15 mm diameter) contained approximately 12.5 mL of media and was stored at room temperature for no longer than one week before being used.
We point‐inoculated each Petri dish (60 × 15 mm diameter) by adding 120 conidia (5 μL of a 24,000 conidia mL−1 conidial suspension) in the center. Each of the 36 diet treatments was replicated three times for each of the eight fungal isolates (N = 864 Petri dishes). After 11 days of growth, each Petri dish was photographed with a camera (Canon EOS 700) in a photo box, ensuring uniform light and focus area and equipped with a reference ruler. Eleven days of growth corresponds to the time when the fastest growing fungus–nutrient combinations had just begun to reach the edge of the Petri dishes, while the slowest growing fungus–nutrient combinations had grown enough to be scored.
Mycelial growth area in square millimeters (Figure 2B) was obtained by analyzing photographs using ImageJ (NIH; v1.52a). Conidia number was obtained from each Petri dish after 15 days of incubation by adding 3 mL of sterile Triton‐X 0.05% solution and then carefully scraping the surface with a sterile spatula to suspend the spores in the solution. We transferred each suspension to a 15‐mL Falcon tube and froze it at −20°C. After defrosting each sample, we performed serial dilutions to adjust each spore concentration into a measurable range. We counted 20 μL of diluted spore suspension in a 0.2‐mm Fuchs‐Rosenthal bright line cytometer with two or three technical replicates of each isolate and nutritional diet combination.
To estimate the effects of P:C diet on the onset of sporulation, we monitored each Petri dish daily for 11 days and used a modified scoring scheme from Fernandes et al. (2010 (link)) where the fungus color was qualitatively evaluated on an eight‐level scale indicating developmental stage from white (hyphal growth) to dark green (mature sporulation). We detail this color scoring scheme in Appendix S1: Table S3 and provide representative images of each species at each color level in Appendix S1: Figure S1. Most isolates exhibited some green coloration by Day 5, but some diet treatments never sporulated by Day 11. For subsequent analyses, we analyzed the onset of sporulation in units of days before the end of the experiment on Day 11 and focused on the first sign of green spores (Category 5 or 6).
We visualized FNN heatmaps using the fields package (Nychka et al., 2021 ) in R (4.3.1) (R Core Team, 2022 ), plotting the response variables growth area (in square millimeters), log10(spore number), and onset day of sporulation across the 36 P:C diet treatments. Red areas indicate high values of response variables and blue areas indicate low values. We set the topological resolution of response surfaces to λ = 0.0005 as a smoothing factor (Shik et al., 2016 (link)) and generated performance isoclines using nonparametric thin‐plate splines. We used least‐square regressions to assess the significance of the linear and quadratic terms (and their linear interaction) for each dependent variable across the P and C diet treatments. These analyses were performed on the mean values across isolates for M. anisopliae (n = 3), M. acridum (n = 3), and M. robertsii (n = 2) used to generate the composite species‐level figures (Appendix S1: Table S4), and at the level of each isolate (Appendix S1: Table S5).
+ Open protocol
+ Expand

Top 5 most cited protocols using «sucrose»

1

Dietary Manipulation in C57Bl/6 Mice

6–8 week old male C57Bl/6 mice (Jackson Laboratory, Bar Harbor, ME) were group-housed in cages in a temperature-controlled vivarium (22±2° C) on a 12-h light/dark schedule at the University of Cincinnati. Animals were randomly assigned to either chow diet (Teklad; Harlan, Madison, WI), high-fat (HF) fed group - Surwit diet, 58 kcal % fat(Research Diets, New Brunswick, NJ) or high-fat high-carbohydrate (HFHC) fed the Surwit diet and drinking water enriched with high fructose corn syrup equivalent. A total of 42 g/L of carbohydrates was mixed in drinking water at a ratio of 55% Fructose (Acros Organics, Morris Plains, NJ) and 45% Sucrose by weight (Sigma-Aldrich, St. Louis, MO). Animals were provided ad-libitum access to these diets for 16 weeks. Body weights were measured weekly while percent body fat was measured at 12 weeks using Echo MRI (Echo Medical Systems, Houston, TX) All animal experiments were approved by the Institutional Animal Care and Use Committee of the University of Cincinnati and Cincinnati Children’s Hospital Medical Center.
+ Open protocol
+ Expand

Corresponding organizations : University of Cincinnati Medical Center, Cleveland Clinic, University of Cincinnati, Cincinnati Children's Hospital Medical Center

2

Conditional RNAi Leukemia Modeling

All mouse experiments were approved by the Cold Spring Harbor animal care and use committee. For conditional RNAi experiments in vivo, Tet-on MLL-AF9/NrasG12D leukaemia cells were transduced with TRMPV-Neo-shRNA constructs, followed by transplantation into sub-lethally irradiated recipient mice, as described previously10 . For shRNA induction, animals were treated with doxycycline in both drinking water (2 mg ml−1 with 2% sucrose; Sigma-Aldrich) and food (625 mg kg−1, Harlan laboratories). For JQ1 treatment trials, a stock of 100 mg ml−1 JQ1 in DMSO was diluted 20-fold by dropwise addition of a 10% 2-hydroxypropyl-β-cyclodextrin carrier (Sigma) under vortexing, yielding a 5 mg ml−1 final solution. Mice were intraperitoneally injected daily with freshly diluted JQ1 (50 or 100 mg kg−1) or a similar volume of carrier containing 5% DMSO.
+ Open protocol
+ Expand

Corresponding organizations : Cold Spring Harbor Laboratory, Ludwig Boltzmann Cluster for Cardiovascular Research, Medical University of Vienna, Johns Hopkins Medicine, Johns Hopkins University, Dana-Farber Cancer Institute, Harvard University, Cincinnati Children's Hospital Medical Center, University of California, San Francisco

3

Sucrose Snacking Modulates FosB Expression

All protocols were approved by the University of Cincinnati Institutional Animal Care and Use Committee and were consistent with NIH guidelines. Single-housed, male Long-Evans rats (250 g) from Harlan Labs (Indianapolis, IN) were housed in a temperature- and humidity-controlled vivarium with a 12-hour/12-hour light cycle (lights on at 06:00 h). All rats received normal rat chow (LM-485 Mouse/Rat sterilizable diet; Harlan-Teklad, Madison, WI) and water ad libitum for the duration of the experiment. After a one-week period of acclimation, rats were randomly assigned to drink treatment groups of either 30% sucrose (Sigma Aldrich Co., St. Louis, MO) solution or water. Rats received a 14-d regimen of twice-daily (9:30 and 15:30 h), brief (maximum of 30 minutes), limited (up to 4 mL) access to their assigned drink solution in an additional sipper bottle on the homecage. Rats readily drank the sucrose in amounts near or at the maximum for the duration of the study, whereas the control rats drank little or none of their additional water (data not shown, see [10 (link)] for typical intake). Drink treatment terminated on Day 14, after which rats no longer received access to their respective experimental drink solution. To test persistence of the sucrose effects, cohorts of animals were killed 1, 6, and 21 days after the snacking paradigm ended (corresponding to days 15, 20 and 35 after commencement of the sucrose delivery (see Figure 1). Groups of animals killed at each time point included: 1) Water - No restraint stress (n=12), 2) sucrose - No restraint stress (n=12), 3) Water - With restraint stress (n=12), and 4) sucrose - With restraint stress (n=13) (a total of 147 rats in the study). The `no restraint stress' groups did not receive a stress challenge, and were injected with pentobarbital and perfused with 0.9% saline followed by 4% paraformaldehyde for collection of brains. The `with restraint stress' groups received a 20-min restraint stress challenge and blood samples were taken by tail clip at 0, 20, 40, and 60 min after the onset of stress. Briefly, rats were placed into well-ventilated restraint tubes and 0-min tail clip blood samples (200 μl) were quickly collected into chilled tubes containing EDTA. The 0-min sample was completed in less than 3 min from first handling each rat's cage, thereby ensuring plasma ACTH and corticosterone levels that were reflective of the basal, unstressed state [17 ]. Rats remained in the restrainers for 20 min, with a second tail blood collection occurring immediately prior to their removal from the restraint tubes (i.e., 20-min after the onset of restraint). At 40 and 60 min after the initiation of restraint, the rats were briefly returned to the restraint tubes (< 3 min) for collection of 40- and 60-min blood samples. It took less than 3 min to collect each post-stress blood sample. Blood samples were centrifuged (3000 g, 15 min, 4° C) and plasma was stored at −20° C until measurement of plasma corticosterone levels via radioimmunoassay (Corticosterone Double Antibody 125I RIA Kit, MPBiomedicals, Solon, OH). Sipper “snack” intake, food intake, and body weight were monitored throughout the experiment. In this paradigm, sucrose rats typically decrease their chow intake isocalorically, resulting in no effect on body weight or fat depot weights [10 (link)].
Brains were prepared for immunohistochemistry as described previously [18 (link)]. Total FosB protein (FosB/deltaFosB) was detected by free floating immunocytochemistry using standard protocols with a rabbit polyclonal primary antibody against a protein corresponding to amino acids 75–100 of the human FosB/deltaFosB (FosB (H75) 1:300 from Santa Cruz Biotechnology (Santa Cruz, CA)). Western blot analysis with this FosB/deltaFosB antibody immunoreacts with two bands, one at 35–37 kD and one at 45 kD corresponding with truncated deltaFosB (a truncated splice variant of the full length FosB protein) and the full length FosB protein respectively [19 (link)]. Primary antibody was detected using biotinylated goat anti-rabbit IgG (1:500 Vector Labs Burlingame, CA), incubated with avidin-horseradish peroxidase complex (1:500; ABC Elite Kit, Vector Laboratories), and reacted with 0.02% diaminobenzidine (DAB, Sigma-Aldrich, St. Louis, MO) for 15 minutes, resulting in a brown reaction product. Sections were mounted onto slides, dehydrated in a graded ethanol series, cleared with xylene, and coverslipped with DPX. An observer blind to the treatment group assignments counted positively-stained neurons in the BLA and NuAc using Image J software (NIH).
The number of rats used in these studies was based on a priori power analyses using expected differences and variation based on our preliminary hormone and immunocytochemistry studies. Differences in the food intake, body weight and hormone data were determined using repeated measures two-way ANOVA. If group differences were present, then Fisher's least significant comparisons procedure was used to determine specific planned pairwise comparisons; no further adjustments were made to control for the experimentwise error rate. Differences in the numbers of FosB/deltaFosB-labeled cells between water and sucrose groups at each time point were determined using separate one-tailed t-tests based on the a priori hypothesis that sucrose snacking will increase synaptic plasticity and synaptic activity. Outliers were removed only if they differed from the mean by more than 1.96 times the standard deviation and they were outside the lower or upper quartiles by more than 1.5 times the interquartile range [20 ]. Data are shown as means ± SEM. Statistical significance was taken as p < 0.05.
+ Open protocol
+ Expand

Corresponding organizations : University of Cincinnati

4

Optimized Extraction and Quantification of Myeloperoxidase Activity from Mouse Organs

Anesthetized mice were transcardially perfused with 20 mL PBS to clear the intravascular compartment of blood cells. For analysis of whole tissue MPO activity, brains were harvested and homogenized by a mechanical homogenizer (Tissuemiser, Fisher Scientific, Waltham, MA) in 500 µl CTAB buffer (50 mM cetyltrimethylammonium bromide [CTAB, Sigma] in 50 mM potassium phosphate buffer at pH = 6), sonicated, and centrifuged at 15,000 g for 20 min. The supernatant was used for protein analysis with a BCA protein assay kit (Thermo Scientific, Waltham, MA) and for MPO activity assays. For separation of extra- (ECF) and intracellular protein fractions (ICF) we modified a method initially described for mouse brains [24] (link). We washed harvested organs (kidney, brain, liver, heart, spleen, and lungs) three times in PBS and incubated them for 2 hours in extraction buffer (0.32 M sucrose [Sigma], 1 mM CaCl2 [Sigma], 10 U/ml Heparin [APP Pharmaceuticals, Schaumburg, IL] in Hanks Balanced Salt Solution [HBSS]). Then, organs were removed from the solution and processed in the same way as for whole tissue MPO activity to obtain the ICF. The extraction buffer containing the ECF was then centrifuged at 1000 g for 5 min to pellet any cellular debris, and the supernatant underwent protein precipitation by slow mixing with 4 parts ice-cold acetone (Fisher Scientific). This was performed in order to concentrate the very dilute extracellular fraction. The acetone-protein mixture was then incubated for 1 hour at −20°C, and proteins were precipitated by centrifugation at 3500 g for 15 min at 4°C. The supernatant was discarded, and the protein pellet was air-dried and resuspended in PBS for BCA and MPO activity assays.
Optimal protein precipitation conditions for MPO were tested by using purified human MPO (1.7 mg/ml; Lee Biosolutions, St. Louis, MO). 0.24, 0.12, 0.06 and 0.03 pmol MPO were precipitated with either acetone or ammonium sulfate as previously described [25] . Recovery of MPO after precipitation was compared to unprecipitated MPO activity using 10-acetyl-3,7-dihydroxyphenoxazine (ADHP, AAT Bioquest, Sunnyvale, CA) as described below.
+ Open protocol
+ Expand

Corresponding organizations : Massachusetts General Hospital, Center for Systems Biology, Harvard University, McGill University, Jewish General Hospital, Far Eastern Memorial Hospital

5

Purification of Waddlia chondrophila from Acanthamoeba


Waddlia chondrophila WSU 86-1044, ATCC number VR-1470, was grown at 32°C within Acanthamoeba castellanii ATCC 30010 in 75 cm2 cell culture flasks (Becton Dickinson, Franklin Lakes, USA) with 30 ml of peptone-yeast extract glucose broth. To purify W. chondrophila, amoebae were removed from culture media using a first centrifugation step at 120×g for 10 min. Amoebal debris were next removed from the resuspended bacterial pellet by centrifugation at 6500 x g for 30 min onto 25% sucrose (Sigma Aldrich, St Louis, USA) and then at 32000 x g for 70 min onto a discontinuous Gastrographin (Bayer Schering Pharma, Zurich, Switzerland) gradient (48%/36%/28%). The bacteria clustering in the Gastrographin gradient at a large lower band were collected, centrifuged at 5800 x g and resuspended in PBS twice, and finally stocked at −80°C. The absence of contaminants was confirmed by plating frozen material on Chocolate agar. Since no growth was observed on agar after 72 h of incubation, frozen material was inoculated onto A. castellanii and immunofluorescence was performed using specific anti-Waddlia antibodies as well as DAPI-staining. We observed no DAPI-positive particles that were not stained with the anti-Waddlia antibodies. In addition, a PCR targeting Eubacteria 16S rRNA followed by sequencing was performed with primers FD1 (5′agagtttgatcctggctcag3′) and RP2 (5′acggctaccttgttacgactt3′).
+ Open protocol
+ Expand

Corresponding organizations : University of Lausanne, Bielefeld University, Queensland University of Technology, University of Zurich

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!

🧪 Need help with an experiment or choosing lab equipment?
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
1. Protocol search & design
(papers, patents, application notes)
2. Protocol validation
(from literature and MDAR)
3. Lab Product search
4. Product validation from literature
5. Troubleshoot product/ protocol
6. Instant figure generation New
Want to copy this response? Create your account to unlock copy/paste and export options.