Tri reagent

Total RNA was isolated from root tissue with TriReagent (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions. The purity and amount of RNA preparations were determined spectrophotometrically using NanoDrop ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA). Samples displaying the 260/280 and 230/260 ratios between 1.8 and 2.0 were used for further analysis. After treatment with RNase-free DNase I (Thermo Fisher Scientific, Waltham, MA, USA), the purified RNA samples were used as a template for first strand cDNA synthesis with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA) according to the manufacturer’s instructions. Synthesized cDNA was used for real-time PCR performed with a LightCycler 480 system (Roche, Basel, Switzerland) and the Real-Time 2xPCR Master Mix SYBR kit (A&A Biotechnology, Gdańsk, Poland). The amplification conditions were as follows: 30 s at 95 °C; 35–40 cycles of 10 s at 95 °C; 10 s at 56 °C (for NR genes) and 60 °C (for ARC gene); 12 s at 72 °C; and final melting for 15 s at 65 °C. Melting curve analysis was performed to confirm the specificity of the amplicons. A dilution of the samples with the lowest crossing point (Cp) was used as a standard curve with an amplification efficiency of around 2. The expression of genes encoding the cucumber tonoplast intrinsic protein, CsTIP41, and the clathrin adaptor complex subunit, CsCACS, were used as the internal standards [61 (link)]. The sequences of primers specific to amplified genes were designed using LightCycler ProbeDesign software 2 (Roche, Basel, Switzerland) and are listed in Table 3.

Specimens identified as A. mixtum were individually processed using the TRI reagent (Sigma-Aldrich, St. Louis, MO, USA), a mixture of guanidinium thiocyanate and phenol, following the manufacturer’s protocol. DNA concentration and purity were assessed using a Nanodrop ONE^® spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) via the quantification of nucleic acids at an optical density of 260 nm, with the ratio of absorbance set at 260/280 nm.

Viral RNA of infected culture supernatants was isolated with Nucleo Spin RNA Virus Kit (Machery Nagel) and total cellular RNA using TriReagent (Sigma-Aldrich) according to manufacturers’ protocol. Cellular DNA was digested with rDNaseI using the TURBO DNA-free DNase kit (Ambion). For reverse transcription into cDNA, we used random hexamer primers (Qiagen), SuperScript III reverse transcriptase (Thermo Fisher), and RNaseOut (Thermo Fisher). qPCR was performed with Luna Universal qPCR master mix (New England Biolabs). For quantitative PCR, we used the following primers: FADS2 fw TGACCGCAAGGTTTACAACAT, FADS2 rev AGGCATCCGTTGCATCTTCTC, ELOVL4 fw GAGCCGGGTAGTGTCCTAAAC, ELOVL4 rev CACACGCTTATCTGCGATGG, 18S rRNA fw GTAACCCGTTGAACCCCATT, 18S rRNA rev CCATCCAATCGGTAGTAGCG DENV fw GCAGAAACACAACATGGAACRATAGT, DENV rev TGATGTAGCTGTCTCCRAATGG, OAS1 fw GCCCTGGGTCAGTTGACTGG, OAS1 rev TGAAGCAGGTGGAGAACTCGC, RSDA2 sense qPCR TTGGACATTCTCGCTATCTCCT RSDA2 as qPCR AGTGCTTTGATCTGTTCCGTC, IFNα sense TCCATGAGATGATCCAGCAG IFNαA as ATTTCTGCTCTGACAACCTCC IFNβB qPCR sense GCTTGGATTCCTACAAAGAAGCA, IFNβB qPCR as ATAGATGGTCAATGCGGCGTC.