Log In Sign up
The largest database of trusted experimental protocols

Cas9 protein

Manufactured by Aldevron
Visit Supplier
Sourced in United States

Cas9 protein is a genome-editing tool derived from the CRISPR-Cas9 system. It functions as a programmable endonuclease, capable of introducing targeted double-strand breaks in DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

4D-Nucleofector, Lonza (2 mentions) Guide RNA, Synthego (1 mentions) P3 Primary Cell Solution, Lonza (1 mentions) CryoStor10, STEMCELL (1 mentions) Dynabeads Human T-Expander CD3/CD28, Thermo Fisher Scientific (1 mentions) EasySep Human CD4+ T Cell Isolation Kit, STEMCELL (1 mentions) T7 endonuclease I, New England Biolabs (1 mentions)

4 protocols using Cas9 protein

1

CRISPR-Cas9 Targeting of COL7A1, TRAC, and AAVS1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Guide RNAs were obtained from Synthego (Redwood City, CA, USA) and were used at a concentration of 1 μg with 10 μg of Cas9 protein (Aldevron, Fargo, ND, USA) or 1 μg of mRNA (TriLink, San Diego, CA, USA). Guide RNA target sequences (5′-3′) were:

COL7A1-1: GGCAGUAAAAGCCGUCAGCU

COL7A1-2: GCGGACGCGCAGGCAAGACC

COL7A1-3: AGAAAAGUCCCUGAUCUCGG

TRAC: GAGAAUCAAAAUCGGUGAAU

AAVS1: GUCACCAAUCCUGUCCCUAG

Osborn M.J., Lees C.J., McElroy A.N., Merkel S.C., Eide C.R., Mathews W., Feser C.J., Tschann M., McElmury R.T., Webber B.R., Kim C.J., Blazar B.R, & Tolar J. (2018). CRISPR/Cas9-Based Cellular Engineering for Targeted Gene Overexpression. International Journal of Molecular Sciences, 19(4), 946.
+ Open protocol
+ Expand
2

Genome Editing of HSPCs Using CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CCR5 gRNA used was chemically modified and purchased from TriLink BioTechnologies (San Diego, CA, USA). The sequence was previously described:9 (link) 5′-GCAGCATAGTGAGCCCAGAA-3′. Cas9 protein was purchased from Aldevron (Fargo, ND, USA). For intracellular delivery, the RNP, Cas9, and gRNA were complexed by pre-mixing at room temperature at a molar ratio of 1:2.5 and were electroporated in HSPCs 48 h after CD34+ isolation using Lonza Nucleofector 4D, program DZ-100, in P3 primary cell solution. One million cells were electroporated in 100 μL with 30 μg Cas9 protein complexed with 15 μg gRNA. Immediately after electroporation, cells were rescued with warm growth culture media, and rAAV6 vectors were added as 10,000 viral genomes/cell (vg/cell) (IDUA, IDUA-tNGFR, IDUA-YFP) or 4–6,000 (YFP). Mock electroporated controls without RNP or with RNP only were included.
Poletto E., Colella P., Pimentel Vera L.N., Khan S., Tomatsu S., Baldo G, & Gomez-Ospina N. (2022). Improved engraftment and therapeutic efficacy by human genome-edited hematopoietic stem cells with Busulfan-based myeloablation. Molecular Therapy. Methods & Clinical Development, 25, 392-409.
+ Open protocol
+ Expand
3

GNTI-122 Gene-Engineered CD4+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GNTI-122 engineering strategy was adopted from methods developed in the Rawlings laboratory (20 (link)). CD4+ T cells were isolated from 3 healthy donors and 3 donors with T1D by negative selection using the EasySep human CD4+ T-Cell Isolation Kit (STEMCELL Technologies) and cryopreserved in CryoStor 10 (STEMCELL Technologies). On day 0, the CD4+ T cells were thawed and activated using Dynabeads Human T-Expander CD3/CD28 (Thermo Fisher Scientific) per manufacturer’s recommendations. Following activation, cells were gene edited by electroporating with 2 RNPs; each RNP consisted of Cas9 protein (Aldevron) and an sgRNA (BioSpring) targeting either the FOXP3 or TRAC locus; transgene templates carrying MND-CISCβ-dFRB for FOXP3 loci and MND-CISCγ-IGRP305-TCR for the TRAC loci were delivered via adeno-associated virus serotype 6 (AAV6) (Supplemental Figure 1A). Successfully dual-engineered cells were enriched and expanded with rapamycin and a secondary activation step, and cryopreserved after purity exceeded 80%. GNTI-122 cells and their corresponding Mock cells, which were electroporated but not treated with RNP or AAV6, were analyzed by flow cytometry during the production process 3 days after editing and on the day of cryopreservation to determine the editing efficiency and purity.
Uenishi G.I., Repic M., Yam J.Y., Landuyt A., Saikumar-Lakshmi P., Guo T., Zarin P., Sassone-Corsi M., Chicoine A., Kellogg H., Hunt M., Drow T., Tewari R., Cook P.J., Yang S.J., Cerosaletti K., Schweinoch D., Guiastrennec B., James E., Patel C., Chen T.F., Buckner J.H., Rawlings D.J., Wickham T.J, & Mueller K.T. (2024). GNTI-122: an autologous antigen-specific engineered Treg cell therapy for type 1 diabetes. JCI Insight, 9(6), e171844.
+ Open protocol
+ Expand
4

CRISPR-Cas9 Editing of Murine Pklr Introns

Check if the same lab product or an alternative is used in the 5 most similar protocols
Guide sequences targeting the intronic HERMs of murine Pklr gene were designed using online tools (http://www.idtdna.com/). Chemically modified crRNAs and tracrRNA were purchased from IDT and Cas9 protein was purchased from Aldevron. 100 pmole of crRNA was mixed with 100 pmole of tracrRNA and incubated at 37°C for 30 min. 8 μg of Cas9 protein was added to the mixture and incubated at 37°C for 15 min to form RNP complex. 2 × 105 G1E-ER-GATA1 cells were resuspended in 20 μL P3 buffer with 22% supplement (Lonza) and added to the RNP complex. Electroporation was done using EO-100 program on Nucleofector 4D (Lonza). 72 h after nucleofection, genomic DNA was extracted from the cell population and subjected to T7 endonuclease assay to detect mutation. Genomic DNA flanking the target site was amplified by PCR and amplicons were denatured, reannealed, and incubated with T7 endonuclease I (New England BioLabs) for 15 min at 37°C. The amplicons were sequenced and analyzed by TIDE to estimate editing efficiency.
Liao R., Zheng Y., Liu X., Zhang Y., Seim G., Tanimura N., Wilson G.M., Hematti P., Coon J.J., Fan J., Xu J., Keles S, & Bresnick E.H. (2020). Discovering How Heme Controls Genome Function Through Heme-omics. Cell reports, 31(13), 107832.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!