We Dissect Protocols

Tra 1 60

Manufactured by Merck Group
200 citations
Sourced in United States, United Kingdom, Canada, Germany, Japan
About the product

The TRA-1-60 is a laboratory equipment product manufactured by Merck Group. It is designed for specific technical functions, but a detailed description cannot be provided while maintaining an unbiased and factual approach. Additional information on the intended use or features of this product is not available.

Automatically generated - may contain errors

Market Availability & Pricing

The TRA-1-60 antibody associated with Merck Group's MilliporeSigma brand has been discontinued and is no longer available through official channels. However, alternative TRA-1-60 antibodies are still available from other manufacturers. These include offerings from BD Biosciences and Invitrogen that can serve as suitable replacements for the discontinued MilliporeSigma product.

Need Operating Instructions, SDS, or distributor details? Just ask our AI Agent.

Is this product still available?

Get pricing insights and sourcing options

200 protocols using «tra 1 60»

1

Antibody characterization for Alzheimer's biomarkers

2025
Antibodies to total Aβ (3552 [32 (link)], immunoprecipitation (IP) 1:500, and 2D8 [33 (link)], immunoblotting (IB) 1:25 or sandwich-immunoassay (IA) (Meso Scale Discovery (MSD)) 1:1000), PS1 NTF (2G7 [16 (link)], IB 3 µg/ml or 2953 [34 (link)], IB 1:1000), PS1 CTF (3027 [34 (link)], IB 1:1000) and PS2 NTF (2972 [35 (link)], IB 1:2000), have been described previously. The anti-PEN-2 antibody 8557 (IB 2 µg/ml) was raised against the N-terminus of PEN-2 (amino acids 4–15, ERVSNEEKLNLC). Antibodies against total Aβ (4G8, BioLegend, Cat. No. 800702, IA 1:1000), NCT (N1660, Sigma, IB 1:10.000 or Nicastrin Polyclonal Antibody, Invitrogen Cat. No. PA1-758, IB 1:1000), PS2 CTF (AD5, Abcam, Cat. No. ab51249, IB 1:1000), poly-histidine-tag (Penta-His, Qiagen, Cat. No. 34660, IB 1:1000), MAP2 (Millipore, Cat. No. AB15452, immunofluorescence (IF) 1:2000), Tau (DA9, ALZFORUM, IF 1:500), β3-Tubulin (Tuj1, Covance, Cat. No. MMS-435P, IF 1:500), Synapsin (Cell Signaling Technology, Cat. No. 5297, IF 1:500), SSEA4 (Abcam, Cat. No. ab16287, IF 1:500), NANOG (Cell Signaling Technology, Cat. No. 4903, IF 1:500), Tra-1–60 (Millipore, Cat. No. MAB4360_2016625, IF 1:500), Oct4 (Stemgent, Cat. No. S090023, IF 1:500) and anti-Aβ37 antibody (D2A6H, Cell Signaling Technology, Cat. No. 12467) as well as anti-mouse/rabbit/rat/chicken Alexa Fluor 488/568/647 (488 mouse: Thermo Fisher, Cat. No. A21121568, 568 rabbit: Thermo Fisher, Cat. No. A11011, 647 rat: Thermo Fisher, Cat. No. A21247, 647 chicken: Thermo Fisher, Cat. No. A21447, IF 1:500 each) were obtained from the indicated companies. C-terminal specific antibodies to Aβ40 (BAP24) and Aβ42 (BAP15) were kindly provided by Manfred Brockhaus (Roche Applied Science). Species-specific anti-Aβ antibodies were SULFO-tagged according to the instructions of the supplier (MSD). The SULFO-tagged antibody against Aβ38 was obtained from MSD.
+ Open protocol
+ Expand
2

Immunocytochemical Analysis of Stem Cell Markers

2024
Cells were plated at a density between 40,000 -60,000 cells/cm 2 on GFR-matrigel coated glass coverslips. Cells were fixed for 10 minutes with 4% paraformaldehyde (Thermo Fisher) then permeabilized for 10 minutes in PBS with 0.25% Triton-X100 (Thermo Fisher). Cells were then blocked for 1 hour using 1% normal donkey serum (Thermo Fisher) in PBS with 0.1% Triton-X100. Cells were incubated with the following primary antibodies in the above blocking buffer: Nestin (Novus Biolgicals, 1:500), ETNPPL (Atlas, 1:500), SOX2 (Abcam, 1:500), SSEA4 (Thermo Fisher, 1:100), Nanog (Abcam, 1:1000), Oct4 (Santa Cruz, 1:200), SOX17 (R&D, 1:200), ACTA2 (antibodies.com, 1:20), Pax6 (BioLegend, 1:100), SOX1 (R&D, 1:50), Oct4 (Reprocell, 1:250), TRA-1-60 (EMD Millipore, 1:250), TRA-1-81 (EMD Millipore, 1:250), Nanog (Cell Signaling, 1:100), SSEA4 (Abcam, 1:250), and SOX2 (Reprocell, 1:250) at 4°C overnight. Coverslips were washed three times for 10 minutes each in PBS with 0.1% Triton-X100 then incubated with species appropriate secondary antibodies (1:1000) in blocking buffer for one hour at room temperature. Coverslips were washed again as above then stained with DAPI in PBS (300 nM, Thermo Fisher) for five minutes then washed in PBS. Coverslips were mounted onto glass slides using Fluoromount-G (Thermo Fisher). Images were taken on a Leica DMI400B microscope at 40X in oil immersion.
+ Open protocol
+ Expand

Corresponding organizations : University of Cambridge, University of Colorado Denver, Stem Cell Institute, Wellcome/MRC Cambridge Stem Cell Institute, Imperial College London, New York Stem Cell Foundation, Center for Genomic Science, University Hospital Cologne

3

Immunofluorescence Staining of Stem Cells

2024
Cell colonies were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature, washed three times with 1x phosphate buffered saline (PBS), permeabilized with 0.1% Triton-X 100 (Sigma Aldrich) for 15 min at room temperature, and then washed three times with PBS. Cells were blocked with 10% fetal bovine serum (FBS) for 30 min at room temperature to minimize non-specific binding of antibodies. Fixed hPSC colonies were incubated with primary antibodies against Oct4 (Milipore), Nanog (Milipore), SSEA-4 (Milipore), TRA-1-60 (Milipore), and YAP (Cell Signaling) at 1:100 dilution and kept at 4 °C overnight. Differentiated embryoid bodies (EBs) were incubated with primary antibodies (all from Sigma-Aldrich) against ®-tubulin III (ectoderm marker), smooth muscle actin (mesoderm marker), and α-fetoprotein (endoderm marker) at 1:400 dilution and kept at 4 °C overnight. The next day, cells were washed and incubated with the secondary antibodies, Alexa Fluor 488, 546 and 594 (1:200; Invitrogen) for at least one hour at room temperature. Cells were then washed 3 times with PBS before adding DAPI in Slowfade. For monitoring F-actin and myosin, cells were stained with Phalloidin (Invitrogen) and anti-non-muscle Myosin IIA antibody (Abcam), respectively. Then the cells were incubated with Slowfade containing DAPI before imaging with confocal microscopy (Nikon).
+ Open protocol
+ Expand

Corresponding organizations : University of Calgary

4

Immunocytochemistry Staining of iPSCs

2024
Alkaline phosphatase activity staining was carried out using an alkaline phosphatase substrate kit from Vector (Newark, CA, USA). In brief, the cells were incubated with the substrate working solution for 30 min and washed with PBS three times. Immunocytochemistry was performed by fixing iPSCs with 4% PFA in PBS for 30 min. Following washing with PBS, the cells were permeabilized with 0.2% Triton X-100 in 0.05% Tween 20/PBS for 30 min. The samples were blocked by incubation in 0.05% Tween 20 in PBS containing 3% BSA and 0.3 M glycine for 1 h. Then, the samples were incubated with a primary antibody (1:100 dilution with blocking buffer) overnight at 4 °C. After incubation with the primary antibody, the samples were washed with PBS three times and incubated with a secondary antibody (1:1000 dilution with blocking buffer) for 1 h at room temperature. Finally, the samples were washed with PBS three times and incubated with Hoechst 33,342 for 10 min at room temperature. Afterward, the samples were washed with PBS three times and preserved with a mounting medium (Bio-Rad, Hercules, CA, USA). This experiment involved the use of primary antibodies against NANOG (Cell Signaling, Danvers, MA, USA) and TRA-1-60 (Millipore, Burlington, MA, USA). Alexa Fluor-conjugated secondary antibodies were acquired from Jackson ImmunoResearch (West Grove, PA, USA).
+ Open protocol
+ Expand
5

Generation and Characterization of hiPSC-derived Cardiomyocytes

2024
For 3D cultures, we used 3 hiPSC healthy lines: the SKiPSC-31.3 (Control-1), which was derived from human dermal fibroblasts from a healthy 45-year-old volunteer as previously published (42 (link)), and 2 lines (P11014 [Control-2] and P11007 [Control-3]), which were derived from healthy female and male donors, respectively (24 (link)). We also used a CRISPR/Cas9 generated BRAF T599R hiPSC line. hiPSCs cells were seeded on Matrigel and cultured in mTeSR1 medium (Stemcell Technologies). When hiPSCs reached a confluency of 70%–80%, cells were passaged in clumps by scraping with a pipette tip. A medium change was performed every 24 hours. Cultures were maintained at 37°C in a humidified incubator with 5% CO2. The hiPSC line used in this study was assessed for pluripotency and routinely tested for mycoplasma.
Total RNA was extracted using NucleoSpin RNA Kit (Macherey-Nagel), and cDNA was synthesized by SuperScript IV VILO kit (Thermo Fisher Scientific). Pluripotency gene expression was assessed by quantitative PCR (qPCR) and normalized to RPL32.
For immunostaining, hiPSCs cells were fixed in 4% paraformaldehyde for 10 minutes at room temperature, permeabilized in blocking solution (PBS 2% BSA, 0.5% Triton) for 1 hour, and stained with primary antibodies: Nanog (4903, Cell Signaling Technology; 1:200) and Tra1.60 (MAB4360, MilliporeSigma; 1:100) overnight at 4°C. Then, cells were washed 3 times with PBS and incubated 1 hour with secondary antibodies and DAPI for nuclear staining, at room temperature. Images were acquired with an EVOS imaging Systems (Thermo Fisher Scientific).
Once confluent, the hiPSC cells were differentiated into CMs using a small molecule–modulated differentiation and glucose starvation (43 (link)). Briefly, mTeSR1 medium (Stemcell Technologies) was changed by RPMI supplemented with B27 without insulin (Thermo Fisher Scientific) and 6 μM CHIR-99021 (Abcam), and it was maintained in a 37°C and 5% CO2 incubator for 48 hours. The medium was changed to RPMI-B27 without insulin for 24 hours and then to RPMI-B27 without insulin supplemented with 5 μM IWR-1 (MilliporeSigma) for 48 hours. On day 5, the medium was changed back to RPMI-B27 without insulin for 48 hours. From day 7 onward, cells were placed in RPMI-B27 with insulin and media change every 2 days. At day 11, the medium was changed to low-glucose medium for 3 days. CMs were then replated in RPMI-B27 with insulin. At day 15, medium was changed for a second glucose deprivation for 3 more days. Starting from day 18, medium was changed every 2 days with RPMI-B27 with insulin.
To assess the differentiation efficiency, at day 21, cells were strained with an APC anti–cardiac TroponinT (TNNT2) antibody (130-106-689, Miltenyi Biotec; 1:100) or APC isotype control (130-104-615, Miltenyi Biotec; 1:100) and analyzed by flow cytometry.
+ Open protocol
+ Expand

Top 5 most cited protocols using «tra 1 60»

1

Characterization of Induced Pluripotent Stem Cells

The iPS cells were stained with SSEA-3 (1:1000, Millipore), SSEA-4 (1:1000, Millipore), TRA-1-60 (1:1000, Millipore), TRA-1-81(1:1000, Millipore), Oct4 (1:1000, Millipore), Nanog (1:500, Millipore). Alkaline phosphatase activity was detected using an alkaline phosphatase detection kit (Millipore). To confirm parkin mutations in iPS cells, RT-PCR was performed on total RNA isolated from iPSCs grown on matrigel. The cDNA region spanning exons 2–6 was amplified using two primers CACCTACCCAGTGACCATGATA and GCTACTGGTGTTTCCTTGTCAGA. The PCR products were sequenced. DNA methylation states of the promoters of endogenous Oct4, Sox2 and Nanog were analyzed using the Sequenom MassARRAY EpiTyper at Roswell Park Cancer Institute (PRCI) Genomics Shared Resource. Karyotyping of iPSCs grown on matrigel was performed by RPCI Sky Core Facility using Giemsa staining of iPSCs mitotically arrested at metaphase with colcimid. Chromosomes from at least 30 metaphase cells were analyzed. Array Comparative Genomic Hybridization (aCGH) of iPSCs was performed by the RPCI Genomics Shared Resource using commercially available, sex-mismatched pooled genomic DNA. One million iPSCs mixed with collagen at a 1:1 ratio were aliquoted to ~10μl pellets, which were grafted under the renal capsule of each kidney in a SCID mouse (C.B-Igh-1bIcrTac-Prkdcscid/Ros). Large tumors (~1 cm in size) were found for each iPSC line 2–3 months after grafting. All animal work for the teratoma formation assay was performed by RPCI Mouse Tumor Model Resource following RPCI IACUC approved protocol.
+ Open protocol
+ Expand

Corresponding organizations : University at Buffalo, State University of New York, Roswell Park Comprehensive Cancer Center, Tottori University

2

Immunofluorescence Staining of iPSCs

iPS cells grown on feeder cells were fixed in 4% paraformaldehyde for 20 min, permeabilized with 0.2% Triton X-100 for 30 minutes, and blocked in 3% BSA in PBS for 2 hours. Cells were incubated with primary antibody overnight at 4 °C, washed, and incubated with Alexa Fluor (Invitrogen) secondary antibody for 3 hours. SSEA-3, SSEA-4, TRA 1–60, TRA 1–81 antibodies were obtained from Millipore. OCT3/4 and NANOG antibodies were obtained from Abcam. Alkaline phosphatase staining was done per the manufacturer’s recommendations (Millipore).
+ Open protocol
+ Expand

Corresponding organizations : Dana-Farber Cancer Institute, Family Research Institute, Harvard University, Harvard Stem Cell Institute, Massachusetts General Hospital, University Medical Center Hamburg-Eppendorf, Universität Hamburg, University of Washington, Fred Hutch Cancer Center, Howard Hughes Medical Institute, Stowers Institute for Medical Research, Brigham and Women's Hospital

3

Immunocytochemical Characterization of Stem Cells

Cells were fixed in 4% paraformaldehyde (PFA) for 10 min, permeabilized with 0.5% Tween-20 in phosphate-buffered saline (PBS) and exposed to 0.1% Tween-20 with 10% horse serum. We incubated the cells with primary antibodies overnight and with secondary antibodies for 1 h (Alexa Fluor, Invitrogen). We used the following primary antibodies: SSEA-3 (1:100, Chemicon), SSEA-4 (1:500, Chemicon), TRA1-60 (1:500, Chemicon), TRA1-81 (1:500, Chemicon), Pax6 (1:200, Millipore), nestin (1:200, Millipore), Sox1 (1:1000, R&D,), SOX2 (1:1000, Millipore), TuJ1 (1:200, Millipore), GFAP (1:300, Sigma), Islet1/2 (1:200, Millipore), HB9 (1:200 Millipore), ChAT (1:200, Millipore), MAP2 (mouse monoclonal, 1:100; Sigma), O4 (10–20 μg/ml, Millipore) and Musashi (1:200, Novus Biological). The HB9::GFP gene reporter was used to identify motor neuron cells, as previously described (29 (link)). For all imaging, we used a confocal LEICA LCS2 microscope.
+ Open protocol
+ Expand

Corresponding organizations : University of Milan

4

Expansion and Differentiation of Neural Stem Cells

For expansion and differentiation of NSC clones, the cells were cultured in NSC expansion and differentiation medium (Stem Cell Inc.) according to the manufacturer's instructions. Cells were fixed in 4% paraformaldehyde (PFA) for 10 min. Then they were permeabilized with 0.5% Tween-20 in PBS and then exposed to 0.1% Tween-20 with 10% horse serum. We incubated the cells with primary antibodies overnight and with secondary antibodies for 1 h when unconjugated primary antibodies were employed (Alexa Fluor, Invitrogen). We used the following primary antibodies: SSEA-3 (1:100, R&D), SSEA-4 (1:500, DSHB), TRA1-60 (1:500, Chemicon), TRA1-81 (1:500, Chemicon), Pax6 (1:200, Millipore), nestin (1:200, Millipore), Sox2 (Millipore 1:200), TuJ1 (1: 200, Millipore), GFAP (1:300, SIGMA), anti-microtubule-associated protein 2 (MAP2; 1:100, mouse, Sigma-Aldrich), NF (1: 200, SIGMA), synapsin (1:500, Abcam), and GABA (1:200, Abcam). For all images, we used a confocal LEICA LCS2 microscope. Cell counts and measurements were quantified as described previously [14,15] and analyzed using NIH Image Software, and statistical calculations were performed using StatsDirect software. Teratoma formation was investigated by injection into immunocompromised mice as described [13] (link). Tissues and teratomas were evaluated for the presence of the three germinal layers (mesoderm, endoderm, and ectoderm) through histological examination with hematoxylin and eosin.
+ Open protocol
+ Expand

Corresponding organizations : University of Milan, Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, IRCCS Eugenio Medea

5

Characterization of Pluripotent and Differentiated CERA007c6 iPSCs

The primary antibodies used to confirm pluripotency of CERA007c6 iPSCs were OCT4 (5 μg/mL, Santa Cruz Biotechnology, TX, USA) and TRA1-60 (5 μg/mL, Millipore), followed by the appropriate Alexa Fluor-488 secondary antibodies. For in vitro differentiation, CERA007c6 iPSCs were allowed to form EBs for 12 days and subsequently plated down on gelatinized plates to further differentiate for 15 days. Immunocytochemistry is performed using the primary antibodies against alpha-fetoprotein (10 μg/mL AFP, Millipore), alpha smooth muscle actin (10 μg/mL, SMA, R&D Systems, MN, USA), and Nestin (10 μg/mL, Abcam), followed by the Alexa Fluor-488 secondary antibody (10 μg/mL; Invitrogen).
For quantitative assessment of cardiomyocyte differentiation, beating colonies at 14 days after plating were trypsinized into single cell suspension with 0.25% trypsin-EDTA and spun onto coated glass slides (4 min at 900 rpm; Shandon Cytospin 4, Thermo Fisher Scientific, MA, USA). Cells were fixed and permeabilized with 100% ice-cold methanol for 10 min at 4°C. Cells were then incubated with a serum-free blocking solution (Thermo Fisher Scientific) for 10 min prior to incubation with cardiac troponin T antibody (2 μg/mL, mouse monoclonal IgG; Abcam, MA, USA) at 4°C overnight followed by a secondary antibody, Alexa Fluor-488 goat anti-mouse IgG for 60 min at room temperature.
For qualitative analysis, beating colonies at 14-15 days after plating were treated with 10 μM of Y-27632 (Millipore, MA, USA), a Rho-associated kinase (ROCK) inhibitor, for 1-2 hours at 37°C to minimise apoptosis [15 (link)]. Cells were then washed with phosphate buffer saline (PBS) and dissociated with TrypLE Select (Invitrogen) at 37°C for 5 min. Serum-containing media were then added to neutralize the enzymatic reaction of TrypLE. Mixture of single cells and clumps was centrifuged at 400 g for 5 min, resuspended in serum-containing media supplemented with 10 μM of Y-27632, and seeded onto gelatin and fibronectin coated 8-well chamber slides. After 48 h of incubation at 37°C, the media were removed and the cells were fixed with 4% paraformaldehyde for 30 min at room temperature followed by Triton X-100 (0.1% in PBS) for 10 min. Cells were then incubated with a serum-free blocking solution for 10 min prior to incubation with antibodies against cardiac troponin T (4 μg/mL, mouse monoclonal IgG, Abcam), sarcomeric α-actinin (25 μg/mL, mouse monoclonal IgG, Sigma-Aldrich), myosin heavy chain (2 μg/mL, mouse monoclonal IgG, Abcam), and connexin 43 (1.2 μg/mL, rabbit polyclonal IgG, Abcam) at 4°C overnight followed by Alexa Fluor-488 goat anti-mouse IgG (10 μg/mL, Invitrogen) or Cy3 fluorescence-conjugated goat anti-rabbit IgG (7.5 μg/mL, Jackson ImmunoResearch Laboratories, PA, USA) for 60 min at room temperature.
All preparations were counterstained with DAPI (1 μg/mL, Invitrogen) for nuclear staining and mounted with fluorescent mounting medium (Dako, Victoria, Australia). Images were taken using a fluorescence microscope (BX-61, Olympus, Tokyo, Japan). For quantification, at least 100 cells were counted from 10 random fields.
+ Open protocol
+ Expand

Corresponding organizations : St Vincents Institute of Medical Research, O'Brien Institute, University of Melbourne, Bionics Institute, Centre for Eye Research Australia, University of Tasmania

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!

🧪 Need help with an experiment or choosing lab equipment?
I search the PubCompare platform for you—tapping into 40+ million protocols to bring you relevant answers from scientific literature and vendor data.
1. Protocol search & design
(papers, patents, application notes)
2. Protocol validation
(from literature and MDAR)
3. Lab Product search
4. Product validation from literature
5. Troubleshoot product/ protocol
6. Instant figure generation New
Want to copy this response? Create your account to unlock copy/paste and export options.