Ls180

The human colon epithelial cell line CCD841 CoN was purchased from the American Type Culture Collection (ATCC, Menassas, VA, USA). The human colon adenocarcinoma cell lines LS180 and HT-29 were obtained from the European Collection of Cell Cultures (ECACC, Centre for Applied Microbiology and Research, Salisbury, UK). The CCD841 CoN cells were grown in Dulbecco’s modified Eagle’s Medium (DMEM). Both the LS180 and HT-29 cells were grown in Dulbecco’s modified eagle medium/nutrient mix F-12 Ham (DMEM/F12). All cell culture mediums were supplemented with 10% foetal bovine serum (FBS), penicillin (100 U/mL), and streptomycin (100 μg/mL). The cells were maintained in a humidified atmosphere of 95% air and 5% CO₂ at 37 °C.

LS180 and HT-29 cell lines were ordered from the European Collection of Cell Cultures (ECACC, Salisbury, UK) and CaCo-2 cell line was ordered from the American Type Culture Collection (ATCC, Menassas, VA, USA). 1:1 mixture of Dulbecco’s Modified Eagle Medium (DMEM) and Ham F-12 nutrient mixture supplemented with 10% Fetal Bovine Serum (FBS) was used to culture LS-180 cells and HT-29 cells. CaCo-2 cell line was cultured using Eagle's Minimal Essential Medium (EMEM) with 20% fetal bovine serum. To culture medium added 100 U/mL of penicillin, and 100 µg/mL of streptomycin. Cell lines were cultured under standard conditions (37 °C, 5% CO₂).
Stock solutions of the examined extracts were prepared by dissolving the appropriate amount of the extract in sterile dimethylsulfoxide (DMSO). Suspensions of CaCo-2, HT-29 and LS180 cells (a density of 5 × 10⁴ cells/mL) were transferred to 96-well cell culture plates (NUNC, Roskilde, Danmark). After 24 h, the culture medium was removed and either fresh medium with the appropriate concentration of extracts (1, 5, 10, 25, 50, 75, 100 µg/mL) or medium without any treatment (control) was added. Cells were incubated for 24 h under standard conditions. DMSO at the concentrations present in the appropriate dilutions of the stock solutions was not cytotoxic for cell lines. After 24 h of incubation, 15 μL MTT working solution (5 mg/mL in PBS) was added to each well. After 3 h, 100 μL of a SDS buffer (10% SDS in 0.01 N HCl) was added to each well. Cells with MTT and SDS were incubated in 37 °C. The absorbance was measured after 24 h at 570 nm using a microplate reader (Epoch, BioTek Instruments, Inc., USA). Gen5 software (v. 2.01, BioTek Instruments, Inc.) was used. The data were expressed as the percentage of the control.

For the cell culture study, human colon adenocarcinoma cell line LS180 and human colonic epithelial cell line CCD841 CoN were purchased from the European Collection of Cell Cultures (ECACC, Centre for Applied Microbiology and Research, Salisbury, UK) and American Type Culture Collection (ATCC, Menassas, VA, USA), respectively. LS180 cells and CCD841 CoN cells were maintained in Dulbecco′s Modified Eagle′s Medium/Nutrient Mixture F-12 Ham and Dulbecco’s Modified Eagle’s Medium (DMEM), respectively. Then, 10% fetal bovine serum (FBS), penicillin (100 U/mL), and streptomycin (100 g/mL) were added to the cell culture media. Cells were incubated in a humidified atmosphere of 95% air and 5% CO₂ at 37 °C.

Eight human CRC cell lines (T84, LOVO, LS174T, HT 29, LS180, SW48, SW480 and COLO205) were selected and purchased from the European Collection of Cell Cultures (ECACC). They were representative of patients with different gender, age and tumor stage.

Human Caucasian colon adenocarcinoma cells LS180 (#87021202) and LS174T (#87060401) and mouse hepatoma Hepa1c1c7 cells (#95090613) were purchased from the European Collection of Cell Cultures (ECACC) and used in passage number 5C12. Stably transfected gene reporter cell line AZ-AHR was described elsewhere [36 (link)]. Cells were maintained at 37 °C and 5% CO₂ in a humidified incubator. Primary human hepatocytes cultures HEP2201014 (male, 76 years) and HEP2201015 (male, 72 years) were purchased from Biopredic International (Rennes, France). Human hepatocytes culture LH79 (male, 60 years) was prepared at the Faculty of Medicine, Palacky University Olomouc. Liver tissue was obtained from Faculty Hospital Olomouc, Czech Republic and the tissue acquisition protocol followed the requirements issued by “Ethical Committee of the Faculty Hospital Olomouc, Czech Republic” and Transplantation law #285/2002 Coll. Primary human hepatocyte cultures were maintained in serum-free cultivation medium.
Immortalized non-tumorigenic human hepatocyte cell line MIHA was a generous gift from Dr. Xia Wang and Dr. Jayanta Roy-Chowdhury (Albert Einstein College of Medicine, Yeshiva University, NY, USA). AhR knock-out (AhR^−/−) and control clones (AhR^+/+) were constructed as follows—Parental line was transiently transfected with a mix of pSpCas9(BB)-2A-GFP (PX458) plasmids encoding two gRNAs (AAGTCGGTCTCTATGCCGCT and AGACCGACTTAATACAGAGT) targeting second exon of the AhR gene. Single cell clones were sub-cultured and successful knock-out was confirmed by western blot.