Total RNA was extracted from the right lung tissue of rats using TRIzol reagent (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. Total RNA was extracted from the right lung tissue of rats using TRIzol reagent (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. A total of 1 µg total RNA was used for reverse transcription with PrimeScript RT Master Mix (TaKaRa, Bio, Inc) according to the manufacturer's protocol. qPCR was performed by using the SYBR® Premix Ex Taq™ II (Takara Bio, Inc.) according to the manufacturer's protocol on a LightCycler 480 System (Roche Diagnostics, Basel, Switzerland). The qPCR reaction mixture consisted of 2 µl cDNA, 10 µl SYBR Premix Ex Taq II (2X), 0.8 µl of 10 uM forward primer, 0.8 µl of 10 uM reverse primer, and 6.4 µl double distilled H2O to a final volume 20 µl. The thermocycling conditions were as follows: 95°C for 30 sec (initial denaturation), followed by 40 cycles of 95°C for 5 sec (denaturation) and 60°C for 30 sec (annealing). Next, a melting curve was performed at 95°C for 5 sec, 60°C for 1 min and then continuously at 95°C, followed by 50°C for 30 sec (cooling). Relative quantification of mRNA was calculated using the 2−ΔΔCq method (29 (link)). The sequences of primers used for RT-qPCR in the present study are demonstrated in Table I . GAPDH gene was used as an internal control.
Trizol reagent
Manufactured by Takara Bio
Sourced in Japan, China, United States, Germany, Puerto Rico
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other components that is used for the isolation of total RNA from cells and tissues. It facilitates the separation of RNA from DNA and proteins during the RNA extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (886 mentions)
Sybr premix ex taq, by Takara Bio (279 mentions)
Primescript rt master mix, by Takara Bio (247 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (225 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (224 mentions)
Reverse transcription kit, by Takara Bio (165 mentions)
Sybr premix ex taq 2, by Takara Bio (139 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (139 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (116 mentions)
Sybr premix ex taq kit, by Takara Bio (111 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (90 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (87 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (84 mentions)
Sybr green pcr master mix, by Takara Bio (83 mentions)
Sybr green, by Takara Bio (78 mentions)
Sybr green pcr kit, by Takara Bio (73 mentions)
Primescript rt kit, by Takara Bio (70 mentions)
Tb green premix ex taq 2, by Takara Bio (69 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (65 mentions)
Primescript rt pcr kit, by Takara Bio (64 mentions)
5 030 protocols using trizol reagent
1
Quantifying Lung Gene Expression in Rats
2
Quantitative Assessment of Gene Expression in Fetal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The placenta, fetal liver, and intestine were removed from the animals and were immediately snap-frozen in liquid nitrogen and ground to a fine powder in a mortar pre-cooled with liquid nitrogen. Total RNA was extracted by Trizol reagent (Trizol reagent, Takara). All the procedures were performed according to the manufacturer's protocols. RNA expression was determined using quantitative real-time PCR. The genes listed in Table 2 were amplified by cDNA specific primers (Invitrogen, USA) on a Thermal Cycler (CHRMO4-TM Thermal Cycler; Bio-Rad, Hercules, CA, USA), according to the manufacturer's instructions and the following protocol: 95°C for 10 s, 40 cycles at 95°C for 5 s; and 60°C for 25 s. Melt curve conditions ranged from 65 to 95°C, reading every 0.5°C and holding for 5 s every 0.5°C (temperature change velocity: 0.5°C). The relative expression levels of gene expression were normalized to those of the eukaryotic house-keeping gene, β-actin.
3
Quantifying RPE gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the CNV and the subretinal fibrosis models, RPE–choroid complexes were isolated on days 1, 3, 5, and 7 after model establishment. We used TRIzol reagent (TaKaRa, Japan) to extract total RNA from the RPE–choroid complexes. Subsequently, the mRNA was reverse transcribed using a PrimeScript RT reagent Kit (TaKaRa, Japan), according to the manufacturer’s instructions. qRT-PCR was performed using SYBR green real-time PCR mix (TaKaRa, Japan).
In the RPE cultures, total RNA was extracted using the TRIzol reagent. Then, we used the same steps to perform qRT-PCR. Target sequences were amplified using the following primer pairs: VEGF, 5′-GTTCACTGTGAGCCTTGTTCAG-3′ and 5′-GTCACATCTGCAAGTACGTTCG-3′; TGF-β2, 5′-GGATGGAAATGGATCCATGAACCC-3′ and 5′-TGTTGTACAGGCTGAGGACTTTGG-3′; and β-actin, 5′-GATGACCCACAGATCATGTTTGA-3′ and 5′-GGAGAGCATAGCCCTCGTAG-3′. All estimated mRNA levels were normalized to β-actin mRNA levels.
In the RPE cultures, total RNA was extracted using the TRIzol reagent. Then, we used the same steps to perform qRT-PCR. Target sequences were amplified using the following primer pairs: VEGF, 5′-GTTCACTGTGAGCCTTGTTCAG-3′ and 5′-GTCACATCTGCAAGTACGTTCG-3′; TGF-β2, 5′-GGATGGAAATGGATCCATGAACCC-3′ and 5′-TGTTGTACAGGCTGAGGACTTTGG-3′; and β-actin, 5′-GATGACCCACAGATCATGTTTGA-3′ and 5′-GGAGAGCATAGCCCTCGTAG-3′. All estimated mRNA levels were normalized to β-actin mRNA levels.
4
Quantification of Gene Expression in LSCC Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In total, five paired LSCC and adjacent nonneoplastic tissues samples were collected from five LSCC patients who underwent surgery in Otolaryngology Department of Gulou Hospital affiliated to Nanjing Medical College, and these tissue samples were then used in this study. The characteristics of patients included in the study are listed in Table A1 . Total RNA from frozen tissue (50–100 mg) homogenized in 1 mL TRIZOL reagent was extracted by TRIZOL reagent (9109, Takara, Japan) according to the manufacturer’s protocol. Then, qRT-PCR was conducted to verify the expressions of several DEGs and DE-lncRNAs identified in this study. mRNA was reversed transcribed to cDNA using primeScript RT Master MIX (RR036A, Takara), and reverse transcription reaction for miRNA was conducted with PrimeScript II RTase 1st Strand cDNA Synthesis Kit (6210A, Takara). Subsequently, amplification was conducted using Power SYBR Green PCR Master Mix (A25742, Thermo) with the reaction conditions as following: 50°C for 3 min, 95°C for 3 min, and 40 cycles of 95°C for 10 s and 60°C for 30 s. GAPDH was applied as internal controls for mRNAs. Table 1 lists the primer sequences of genes. The 2−ΔΔCt method was applied to calculate relative expression of genes.
5
Biotin-coupled probe pull-down and miRNA capture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the biotin-coupled probe pull-down assay, the biotinylated-circNHSL1 probe was specifically designed and synthesized through GenePharma (Shanghai, China), and oligo probe acted as a control. In brief, GC cells (1 × 107) in lysis buffer were incubated with the designed probes for 2 h. Then, the biotin-coupled RNA complex was pull-downed by incubating the GC cell lysates with M-280 Streptavidin magnetic beads (Invitrogen). At 4 h post-incubation, the beads were washed with lysis buffer, and the RNA complexes bound to the beads were extracted with Trizol reagent (TaKaRa) and analyzed by RT-qPCR assay.
For biotin-coupled miRNA capture, GC cells (5 × 106) were transfected with biotinylated miR-149-5p mimic (biotin-miR-149-5p, GenePharma) or nonsense control (biotin-NC, GenePharma) based on the user’s guidebook of Lipofectamine RNAiMax (Invitrogen). At 48 h after transfection, M-280 Streptavidin magnetic beads (Invitrogen) were washed with lysis buffer, followed by blockage with yeast tRNA on the rotator at a low speed (10r/min). After lysis and ultrasonic treatment, GC cells were incubated with the blocked beads at 4°C. The next day, Trizol reagent (TaKaRa) was used to purify bound RNAs, and RT-qPCR assay was conducted to assess the abundance of circNHSL1 in bound fractions.
For biotin-coupled miRNA capture, GC cells (5 × 106) were transfected with biotinylated miR-149-5p mimic (biotin-miR-149-5p, GenePharma) or nonsense control (biotin-NC, GenePharma) based on the user’s guidebook of Lipofectamine RNAiMax (Invitrogen). At 48 h after transfection, M-280 Streptavidin magnetic beads (Invitrogen) were washed with lysis buffer, followed by blockage with yeast tRNA on the rotator at a low speed (10r/min). After lysis and ultrasonic treatment, GC cells were incubated with the blocked beads at 4°C. The next day, Trizol reagent (TaKaRa) was used to purify bound RNAs, and RT-qPCR assay was conducted to assess the abundance of circNHSL1 in bound fractions.
6
Verification of ceRNA Network Hubs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hub RNAs PART1, MIR4435-2 HG and LINC01980 were selected from the ceRNA network and subjected to RT-qPCR analysis to verify the reliability of the bioinformatics findings. The intracellular expression levels of PART1, MIR4435-2 HG and LINC01980 and their expression levels in serum were determined using RT-qPCR. Total cellular RNA was extracted using TrizolTM reagent (Takara, Dalian, Japan). Total serum RNA was extracted using miRcute Serum/Plasma miRNA isolation kit (DP160526, Tiangen Biotech, China). Total RNA was reversely transcribed into cDNA following the manufacturer’s instructions of MightyScript First Strand cDNA Synthesis Master Mix reagent kit (B639251, Sango Biotech, China). The 2X SG Fast qPCR Master Mix kit was employed, and spectrophotometer was used to determine the Ct value for each sample. GAPDH expression was measured and served as endogenous control. The measurement was repeated 3 times (n = 3) for each sample, and the data was analyzed using the 2−ΔΔct method. The following primer sequences were used: (5ʹ3ʹ): MIR4435-2 HG-F: AGGAGGCGGAGCATGGAACTC, MIR4435-2HG-R: CAGGGGAAGCAAGTCTCACACATC, LINC01980-F: CATTGTAGGTGGGTGGGTGACTTC, LINC01980-R: CACTAACACAGGCTGAGCAGACTC, PART1-F: CCAGAGCCAGCCAATCACTTAGC, PART1-R: TGTTGTTCCAGTGCAGCCCTTTC.
7
Tick Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein from the ticks was extracted using the TRIzolTM reagent (Takara, Dalian, China) according to the manufacturer’s instructions, separated on 12% SDS–PAGE gels and transferred to PVDF membranes (Millipore, United States). The membranes were then blocked in TBST containing 5% skim milk for 1 h at room temperature. For the detection of CPR1, the membranes were incubated overnight at 4°C with monoclonal antibodies against CPR1 at a 1:300 dilution and then incubated with a 1:5000 dilution of an anti-rabbit HRP-conjugated secondary antibody (Solarbio, Beijing, China) at room temperature for 1 h. CPR1 expression was detected by chemiluminescence (Thermo Fisher Scientific, United States).
8
Quantifying E7 Expression and circRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was used to identify the E7 expression transfected by E7 siRNA and pEGFP-C3-E7 plasmid as well as confirm the differently expressed circRNAs obtained from the microarray data. Total RNA of Caski and SiHa as well as C33A cells were isolated with TRIzolTM reagent (TaKaRa, Dalian, China) following the manufacturer's protocol. The concentration of RNA was detected by the spectrophotometer of NanoDropTM ND-1000 (Applied Biosystems, CA, USA). Total RNA (≤500 ng) was reverse transcribed into cDNA using the PrimeScriptTMⅡ 1st Strand cDNA Synthesis kit (TaKaRa, Dalian, China). qRT-PCR was performed using the SYBR Premix Ex TaqTM Ⅱ Kit (TaKaRa, Dalian, China). The primers used for amplification were shown in Table 1 . GAPDH was used as internal control. Each experiment was repeated in triplicate. All assays were performed using the ABI 7500 system (Applied Biosystems, CA, USA). The results were calculated by the method of 2-ΔΔCt.
9
Modulating Tick Molting via miRNA Analogs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Agomir (Ag), micrONTM agomir negative control #22 (NC), antagomir (Ant), and micrOFFTM Ant negative control #22 (NC) were synthesized by RiboBio Company (RiboBio, Guangzhou, China).
Five days after blood meal ingestion, H. longicornis nymphs were dosed at a site between the third and fourth legs. The experimental group was administered 800 μM novel miRNA-2 Ag or Ant in 0.2 μL of RNase-free water, the NC group was administered 800 μM micrONTM Ag or micrOFFTM Ant in 0.2 μL of RNase-free water, and no injection was administered to the blank control group. Each group included 50 H. longicornis nymphs collected 5 days after blood meal ingestion.
Thirty ticks were used for observation of the molting timepoint and molting rate, and the rest were used to detect the expression of related genes and proteins. Two days after injection, total RNA and protein were extracted from the ticks using the TRIzolTM reagent (Takara, Dalian, China) in accordance with the manufacturer’s instructions. Moreover, the number of successfully completed molts and the molting timepoints after microinjection were observed and recorded.
Five days after blood meal ingestion, H. longicornis nymphs were dosed at a site between the third and fourth legs. The experimental group was administered 800 μM novel miRNA-2 Ag or Ant in 0.2 μL of RNase-free water, the NC group was administered 800 μM micrONTM Ag or micrOFFTM Ant in 0.2 μL of RNase-free water, and no injection was administered to the blank control group. Each group included 50 H. longicornis nymphs collected 5 days after blood meal ingestion.
Thirty ticks were used for observation of the molting timepoint and molting rate, and the rest were used to detect the expression of related genes and proteins. Two days after injection, total RNA and protein were extracted from the ticks using the TRIzolTM reagent (Takara, Dalian, China) in accordance with the manufacturer’s instructions. Moreover, the number of successfully completed molts and the molting timepoints after microinjection were observed and recorded.
10
SARS-CoV-2 Infection in Lung Epithelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All studies involving SARS-CoV-2 infection were conducted in the biosafety level-3 (BLS-3) laboratory of Shenzhen Third People’s Hospital. Lung epithelial cells Calu3 were infected with SARS-CoV-2 at 1 MOI for 24 and 48 h. Total RNA was extracted with TRIzolTM Reagent in accordance with the manufacturer’s instructions and reverse-transcribed into cDNA with a High-Capacity cDNA Reverse Transcription Kit (Takara, RR036A). The expression levels of indicated RNA were determined by RT-qPCR analysis using Power SYBR Green PCR Master Mix (Vazyme, Q311-02). Primers used in RT-qPCR reactions are listed in Table S4
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!